LOCUS       NM_010449               2250 bp    mRNA    linear   ROD 12-SEP-2023
DEFINITION  Mus musculus homeobox A1 (Hoxa1), transcript variant 1, mRNA.
ACCESSION   NM_010449
VERSION     NM_010449.5
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2250)
  AUTHORS   Petrelli B, Ozturk A, Pind M, Ayele H, Fainsod A and Hicks GG.
  TITLE     Genetically programmed retinoic acid deficiency during gastrulation
            phenocopies most known developmental defects due to acute prenatal
            alcohol exposure in FASD
  JOURNAL   Front Cell Dev Biol 11, 1208279 (2023)
   PUBMED   37397253
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2250)
  AUTHORS   Kessler S, Minoux M, Joshi O, Ben Zouari Y, Ducret S, Ross F,
            Vilain N, Salvi A, Wolff J, Kohler H, Stadler MB and Rijli FM.
  TITLE     A multiple super-enhancer region establishes inter-TAD interactions
            and controls Hoxa function in cranial neural crest
  JOURNAL   Nat Commun 14 (1), 3242 (2023)
   PUBMED   37277355
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2250)
  AUTHORS   Odelin G, Faucherre A, Marchese D, Pinard A, Jaouadi H, Le
            Scouarnec S, Chiarelli R, Achouri Y, Faure E, Herbane M, Theron A,
            Avierinos JF, Jopling C, Collod-Beroud G, Rezsohazy R and Zaffran
            S.
  CONSRTM   FranceGenRef Consortium
  TITLE     Variations in the poly-histidine repeat motif of HOXA1 contribute
            to bicuspid aortic valve in mouse and zebrafish
  JOURNAL   Nat Commun 14 (1), 1543 (2023)
   PUBMED   36941270
  REMARK    GeneRIF: Variations in the poly-histidine repeat motif of HOXA1
            contribute to bicuspid aortic valve in mouse and zebrafish.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2250)
  AUTHORS   Guertin TM, Palaria A, Mager J, Sandell LL, Trainor PA and Tremblay
            KD.
  TITLE     Deciphering the role of retinoic acid in hepatic patterning and
            induction in the mouse
  JOURNAL   Dev Biol 491, 31-42 (2022)
   PUBMED   36028102
REFERENCE   5  (bases 1 to 2250)
  AUTHORS   Zhang H, Xie J, So KKH, Tong KK, Sae-Pang JJ, Wang L, Tsang SL,
            Chan WY, Wong EYM and Sham MH.
  TITLE     Hoxb3 Regulates Jag1 Expression in Pharyngeal Epithelium and
            Affects Interaction With Neural Crest Cells
  JOURNAL   Front Physiol 11, 612230 (2021)
   PUBMED   33505317
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2250)
  AUTHORS   Scott,M.P.
  TITLE     Vertebrate homeobox gene nomenclature
  JOURNAL   Cell 71 (4), 551-553 (1992)
   PUBMED   1358459
REFERENCE   7  (bases 1 to 2250)
  AUTHORS   Langston AW and Gudas LJ.
  TITLE     Identification of a retinoic acid responsive enhancer 3' of the
            murine homeobox gene Hox-1.6
  JOURNAL   Mech Dev 38 (3), 217-227 (1992)
   PUBMED   1360810
REFERENCE   8  (bases 1 to 2250)
  AUTHORS   Nazarali A, Kim Y and Nirenberg M.
  TITLE     Hox-1.11 and Hox-4.9 homeobox genes
  JOURNAL   Proc Natl Acad Sci U S A 89 (7), 2883-2887 (1992)
   PUBMED   1348361
REFERENCE   9  (bases 1 to 2250)
  AUTHORS   Chisaka O, Musci TS and Capecchi MR.
  TITLE     Developmental defects of the ear, cranial nerves and hindbrain
            resulting from targeted disruption of the mouse homeobox gene
            Hox-1.6
  JOURNAL   Nature 355 (6360), 516-520 (1992)
   PUBMED   1346922
REFERENCE   10 (bases 1 to 2250)
  AUTHORS   Fowlis GA, Adelman S, Knight AM and Simpson E.
  TITLE     PCR-analyzed microsatellites of the mouse genome--additional
            polymorphisms among ten inbred mouse strains
  JOURNAL   Mamm Genome 3 (4), 192-196 (1992)
   PUBMED   1611214
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC091106.17.
            
            On Mar 18, 2023 this sequence version replaced NM_010449.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK083575.1, M22115.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849375, SAMN00849381
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-753               AC091106.17        30662-31414
            754-2250            AC091106.17        31892-33388
FEATURES             Location/Qualifiers
     source          1..2250
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 25.4 cM"
     gene            1..2250
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="homeobox A1"
                     /db_xref="GeneID:15394"
                     /db_xref="MGI:MGI:96170"
     exon            1..753
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    93..95
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="upstream in-frame stop codon"
     CDS             99..1109
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="isoform 1 is encoded by transcript variant 1;
                     homeobox protein Hox-A1; early retinoic acid 1; homeobox
                     protein Hox-1.6; homeotic protein ERA-1-993; homeoboxless
                     protein ERA-1-399"
                     /codon_start=1
                     /product="homeobox protein Hox-A1 isoform 1"
                     /protein_id="NP_034579.3"
                     /db_xref="CCDS:CCDS20138.1"
                     /db_xref="GeneID:15394"
                     /db_xref="MGI:MGI:96170"
                     /translation="

MDNARMNSFLEYPILGSGDSGTCSARAYPSDHGITTFQSCAVSANSCGGDDRFLVGRGVQISSPHHHHHHHHHHHPQTATYQTSGNLGISYSHSSCGPSYGAQNFSAPYGPYGLNQEADVSGGYPPCAPAVYSGNLSTPMVQHHHHHQGYAGGTVGSPQYIHHSYGQEQQTLALATYNNSLSPLHASHQEACRSPASETSSPAQTFDWMKVKRNPPKTGKVGEYGYVGQPNAVRTNFTTKQLTELEKEFHFNKYLTRARRVEIAASLQLNETQVKIWFQNRRMKQKKREKEGLLPISPATPPGSDEKTEESSEKSSPSPSAPSPASSTSDTLTTSH"

     misc_feature    627..>959
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    order(798..803,807..809,858..860,876..878,915..917,
                     921..926,933..938,942..950,954..959)
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    798..956
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(804..806,924..926,933..938,945..947)
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            754..2250
                     /gene="Hoxa1"
                     /gene_synonym="ERA1; Hox-1.6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gtacattcatatcatttttcttctctggtcctatggaggaagtgagaaagttggcacggtcacccagggcttcgcaggatccaatcactcagtgacagatggacaatgcaagaatgaactcctttctggaataccccatccttggcagtggcgactctgggacctgctcggcgcgagcttacccctctgaccatgggattacaactttccaatcctgcgcggtcagtgccaacagctgcggcggcgacgaccgcttcctagtgggcaggggggtgcagatcagctcgccccaccaccaccaccaccaccaccaccatcaccacccccagacggctacttaccagacttctggaaaccttgggatttcttattcccactcgagttgtggtccaagctatggcgcgcagaacttcagtgcgccttatggcccctatggattaaatcaggaagcagacgtaagtggtgggtaccccccgtgcgctcccgctgtttactctggaaacctctcgactcccatggtccagcatcaccaccaccaccagggttatgctgggggcacagtgggctcgccccagtacattcaccactcatatggacaagagcagcagactctggccctggccacgtataataactccttatcccctctccacgccagccaccaagaagcctgtcgttcccctgcttcagagacgtcttctccagcgcagacctttgactggatgaaagttaaaagaaaccctcccaaaacagggaaagttggagagtacggctacgtgggtcaacccaacgcagtgcgcaccaatttcaccaccaagcagctcacagagctggagaaggagttccacttcaacaagtaccttacacgagcgcgcagggtggagattgccgcgtccctacagctcaatgagacccaggtgaagatctggttccagaatcgccgcatgaagcagaagaagcgtgagaaggaggggctcctgcccatctcccctgccactcctcctggcagcgatgagaaaacggaagaatcatctgagaaatctagcccctcgcccagtgccccttctccggcatcgtctacctcagacactctgactacctcccactgaggctactccagcccaactctgcagcccaggcttctccctgggctgggatttcttacccaaagcacattcttagcttatcttcctttctttacagactctctcttcctttctcgtcccatctggggagctcctggccaagataaggtatttccagagaattctggagccttggttggaagttaactccttcatccacatcgggtgtccacatcaattgctgatggctcccaacatcctttccttcactgttgtgagatttttttctccccacaacctatgattccttttagatgtcggctggagaacagttagttccctttgccatcagacatttgcaggaaggaggcatctctccttttatctatgtattgttcttctccacctagcccttaagtaggacatagaggagagagagtgtccaaagactcatgaagaagagatgcactgtgtttacacaattaattcaccccctaacttagctggtttcatgtgtgtgagtttgctggttgtaaatgctttcccgtcagagatttatctttatacacattttatagaaatatgtaggtcactaaatcaaacagggtggacaaattctcaaaactggtacagttcatgtgtgattatgggcgaaagaagaaaacctctttcattcaaacagagtcagatgcctcagaagttggcctcaattggttctttcagagttaagaaggcctgccaagcactttgcctgtgccaggtcttcccaaactctaaccaattcttcctgcttctctggccaccctgcatttaaaaatcatgctggatcatttgtaacccaaaggtattcattctttcagtcaccctttccttccacactgtcttgtatcatggctggatccagtgtatttccagctaattgttaatgtgatggatggcacaatgaatgtatattttgtgtgattcgtgactagtcttctgcatgtcgcacaatgttctgatgtccctgaaatatcacactgagttctatcagttattctttgtgagcctatgatagtctccatttactgtacaatcatgaacagctctgagatcctggagtgatgtggtccagagcagagtttacgggtcttaagatgtctgtaataaaagtattcaagtttta

//