ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-06-15 15:16:10, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_009370 5713 bp mRNA linear ROD 23-APR-2024
DEFINITION Mus musculus transforming growth factor, beta receptor I (Tgfbr1),
transcript variant 1, mRNA.
ACCESSION NM_009370 XM_977763 XM_977795 XM_988573 XM_988612
VERSION NM_009370.4
KEYWORDS RefSeq; RefSeq Select.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 5713)
AUTHORS Mohamed,F.E.Z.A., Dewidar,B., Lin,T., Ebert,M.P., Dooley,S.,
Meindl-Beinker,N.M. and Hammad,S.
TITLE TGFbetaR1 inhibition drives hepatocellular carcinoma proliferation
through induction of toll-like-receptor signalling
JOURNAL Int J Exp Pathol 105 (2), 64-74 (2024)
PUBMED 38328944
REMARK GeneRIF: TGFbetaR1 inhibition drives hepatocellular carcinoma
proliferation through induction of toll-like-receptor signalling.
REFERENCE 2 (bases 1 to 5713)
AUTHORS Lozovska,A., Korovesi,A.G., Dias,A., Lopes,A., Fowler,D.A.,
Martins,G.G., Novoa,A. and Mallo,M.
TITLE Tgfbr1 controls developmental plasticity between the hindlimb and
external genitalia by remodeling their regulatory landscape
JOURNAL Nat Commun 15 (1), 2509 (2024)
PUBMED 38509075
REMARK GeneRIF: Tgfbr1 controls developmental plasticity between the
hindlimb and external genitalia by remodeling their regulatory
landscape.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 5713)
AUTHORS Bedolla,A.M., McKinsey,G.L., Ware,K., Santander,N., Arnold,T.D. and
Luo,Y.
TITLE A comparative evaluation of the strengths and potential caveats of
the microglial inducible CreER mouse models
JOURNAL Cell Rep 43 (1), 113660 (2024)
PUBMED 38217856
REFERENCE 4 (bases 1 to 5713)
AUTHORS Pluangnooch,P., Soontrapa,K., Pudgerd,A. and Sridurongrit,S.
TITLE Expression of constitutively active TbetaRI leads to attenuation of
ovalbumin-induced allergic airway inflammation associated with
augmented M2 polarization of alveolar macrophage
JOURNAL Respir Investig 62 (1), 90-97 (2024)
PUBMED 38007853
REMARK GeneRIF: Expression of constitutively active TbetaRI leads to
attenuation of ovalbumin-induced allergic airway inflammation
associated with augmented M2 polarization of alveolar macrophage.
REFERENCE 5 (bases 1 to 5713)
AUTHORS Alsamraae,M., Costanzo-Garvey,D., Teply,B.A., Boyle,S.,
Sommerville,G., Herbert,Z.T., Morrissey,C., Dafferner,A.J.,
Abdalla,M.Y., Fallet,R.W., Kielian,T., Jensen-Smith,H.,
deOliveira,E.I., Chen,K., Bettencourt,I.A., Wang,J.M.,
McVicar,D.W., Keeley,T., Yu,F. and Cook,L.M.
TITLE Androgen receptor inhibition suppresses anti-tumor neutrophil
response against bone metastatic prostate cancer via regulation of
TbetaRI expression
JOURNAL Cancer Lett 579, 216468 (2023)
PUBMED 37940068
REFERENCE 6 (bases 1 to 5713)
AUTHORS Iseki,S., Osumi-Yamashita,N., Miyazono,K., Franzen,P., Ichijo,H.,
Ohtani,H., Hayashi,Y. and Eto,K.
TITLE Localization of transforming growth factor-beta type I and type II
receptors in mouse development
JOURNAL Exp Cell Res 219 (2), 339-347 (1995)
PUBMED 7641785
REFERENCE 7 (bases 1 to 5713)
AUTHORS Roelen,B.A., Lin,H.Y., Knezevic,V., Freund,E. and Mummery,C.L.
TITLE Expression of TGF-beta s and their receptors during implantation
and organogenesis of the mouse embryo
JOURNAL Dev Biol 166 (2), 716-728 (1994)
PUBMED 7813789
REFERENCE 8 (bases 1 to 5713)
AUTHORS ten Dijke,P., Yamashita,H., Ichijo,H., Franzen,P., Laiho,M.,
Miyazono,K. and Heldin,C.H.
TITLE Characterization of type I receptors for transforming growth
factor-beta and activin
JOURNAL Science 264 (5155), 101-104 (1994)
PUBMED 8140412
REFERENCE 9 (bases 1 to 5713)
AUTHORS Suzuki,A., Shioda,N., Maeda,T., Tada,M. and Ueno,N.
TITLE A mouse TGF-beta type I receptor that requires type II receptor for
ligand binding
JOURNAL Biochem Biophys Res Commun 198 (3), 1063-1069 (1994)
PUBMED 8117262
REFERENCE 10 (bases 1 to 5713)
AUTHORS Tomoda,T., Kudoh,T., Noma,T., Nakazawa,A., Muramatsu,M. and Arai,K.
TITLE Molecular cloning of a mouse counterpart for human TGF-beta type I
receptor
JOURNAL Biochem Biophys Res Commun 198 (3), 1054-1062 (1994)
PUBMED 8117261
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL772232.18 and AL772150.11.
On Oct 16, 2023 this sequence version replaced NM_009370.3.
Summary: This gene encodes a member of the transforming growth
factor beta (TGF-beta) receptor family of proteins. These proteins
comprise one component of the TGF-beta signaling pathway, which
transduces extracellular signals into gene expression changes to
regulate a wide range of cellular responses, including
proliferation, migration, differentiation and apoptosis. Homozygous
knockout mice for this gene exhibit impaired angiogenesis and
embryonic lethality. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Aug 2015].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC063260.1, SRR13862051.1748573.1
[ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN00849374, SAMN00849375
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-139 AL772232.18 138526-138664
140-385 AL772150.11 13850-14095
386-628 AL772150.11 23348-23590
629-859 AL772150.11 26456-26686
860-1027 AL772150.11 32904-33071
1028-1184 AL772150.11 33471-33627
1185-1309 AL772150.11 35630-35754
1310-1440 AL772150.11 37023-37153
1441-5713 AL772150.11 40753-45025
FEATURES Location/Qualifiers
source 1..5713
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="4"
/map="4 26.02 cM"
gene 1..5713
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="transforming growth factor, beta receptor I"
/db_xref="GeneID:21812"
/db_xref="MGI:MGI:98728"
exon 1..139
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
CDS 55..1566
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/EC_number="2.7.11.30"
/note="isoform 1 precursor is encoded by transcript
variant 1; TGF-beta receptor type-1; TGF-beta receptor
type I; transforming growth factor-beta receptor type I"
/codon_start=1
/product="TGF-beta receptor type-1 isoform 1 precursor"
/protein_id="NP_033396.1"
/db_xref="CCDS:CCDS18160.1"
/db_xref="GeneID:21812"
/db_xref="MGI:MGI:98728"
/translation="
MEAAAAAPRRPQLLIVLVAAATLLPGAKALQCFCHLCTKDNFTCETDGLCFVSVTETTDKVIHNSMCIAEIDLIPRDRPFVCAPSSKTGAVTTTYCCNQDHCNKIELPTTGPFSEKQSAGLGPVELAAVIAGPVCFVCIALMLMVYICHNRTVIHHRVPNEEDPSLDRPFISEGTTLKDLIYDMTTSGSGSGLPLLVQRTIARTIVLQESIGKGRFGEVWRGKWRGEEVAVKIFSSREERSWFREAEIYQTVMLRHENILGFIAADNKDNGTWTQLWLVSDYHEHGSLFDYLNRYTVTVEGMIKLALSTASGLAHLHMEIVGTQGKPAIAHRDLKSKNILVKKNGTCCIADLGLAVRHDSATDTIDIAPNHRVGTKRYMAPEVLDDSINMKHFESFKRADIYAMGLVFWEIARRCSIGGIHEDYQLPYYDLVPSDPSVEEMRKVVCEQKLRPNIPNRWQSCEALRVMAKIMRECWYANGAARLTALRIKKTLSQLSQQEGIKM"
sig_peptide 55..141
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
mat_peptide 142..1563
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/product="TGF-beta receptor type-1. /id=PRO_0000024424"
/note="propagated from UniProtKB/Swiss-Prot (Q64729.1)"
misc_feature 142..366
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="extracellular domain (ECD) found in activin
receptor-like kinase 5 (ALK-5) and similar proteins;
Region: TFP_LU_ECD_ALK5; cd23537"
/db_xref="CDD:467067"
misc_feature 175..177
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q64729.1); glycosylation site"
misc_feature 433..495
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="propagated from UniProtKB/Swiss-Prot (Q64729.1);
transmembrane region"
misc_feature 547..549
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 580..663
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Transforming growth factor beta type I GS-motif;
Region: TGF_beta_GS; pfam08515"
/db_xref="CDD:462503"
misc_feature 607..609
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphothreonine, by TGFBR2.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 610..612
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphothreonine, by TGFBR2.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 613..615
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphoserine, by TGFBR2.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 619..621
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphoserine, by TGFBR2.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 625..627
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Phosphoserine, by TGFBR2.
/evidence=ECO:0000250|UniProtKB:P36897; propagated from
UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site"
misc_feature 631..636
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="propagated from UniProtKB/Swiss-Prot (Q64729.1);
Region: FKBP1A-binding"
misc_feature 679..1542
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Catalytic domain of the Serine/Threonine Kinases,
Transforming Growth Factor beta Type I Receptor and
Activin Type IB/IC Receptors; Region:
STKc_TGFbR1_ACVR1b_ACVR1c; cd14143"
/db_xref="CDD:271045"
misc_feature order(685..699,709..711,742..744,748..750,832..834,
892..903,913..915,919..921,1051..1053,1057..1059,
1063..1068,1072..1074,1105..1107,1114..1116,1174..1185)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="active site"
/db_xref="CDD:271045"
misc_feature order(685..705,709..711,742..744,748..750,892..897,
901..903,913..915,1063..1068,1072..1074,1105..1107)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:271045"
misc_feature order(697..699,913..915,919..921,1051..1053,1057..1059,
1063..1065,1114..1116,1174..1185)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="polypeptide substrate binding site [polypeptide
binding]; other site"
/db_xref="CDD:271045"
misc_feature order(778..783,790..795,802..807,847..849,853..855)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="FKBP12 binding site [polypeptide binding]; other
site"
/db_xref="CDD:271045"
misc_feature 1102..1185
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:271045"
exon 140..385
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 386..628
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 629..859
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 860..1027
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1028..1184
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1185..1309
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1310..1440
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1441..5713
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
regulatory 5692..5697
/regulatory_class="polyA_signal_sequence"
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="hexamer: AATAAA"
polyA_site 5713
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="major polyA site"
ORIGIN
gaggagaagctgcggccggggccgggccgggccacaaacagtggcggcgggaccatggaggcggcggccgctgctccacgtcgtccgcagctcctcatcgtgttggtggcggcggcgacgctgctcccgggggcgaaggcattacagtgtttctgccacctctgtacaaaggataattttacctgtgagacagatggtctttgctttgtctcagtcactgagaccacagacaaagttatacacaatagtatgtgtatagctgaaattgacctaattcctcgagacaggccatttgtatgtgcaccatcttcaaaaacaggggcagttactacaacatattgctgcaatcaggaccactgcaataaaatagaactcccaactacaggacctttttcagaaaagcagtcagctggccttggtcctgtggagctggcagctgtcattgctggtccagtctgcttcgtctgcattgcacttatgctgatggtctatatctgccataaccgcactgtcattcaccaccgtgtgccaaatgaagaggatccatcactagatcgccctttcatttcagagggcaccaccttaaaagatttaatttatgatatgacaacatcagggtctggatcaggtttaccactgcttgttcaaagaacaattgccaggaccattgtgttacaagaaagcattggcaaaggtcggtttggagaagtttggcgaggcaaatggcggggagaagaagttgctgtgaagatattctcttctagagaagagcgttcatggttccgagaggcagagatttatcagactgtaatgttacgccatgaaaatatcctgggatttatagcagcagacaacaaagacaatgggacatggacgcagctgtggttggtgtcagattatcatgagcatggatcccttttcgattacttgaatagatacactgttactgtggaaggaatgatcaagcttgctctgtccacagcaagtggtcttgcccatcttcacatggagattgttggtacccaaggaaaaccagctattgcccatagagatttgaaatcaaagaatatcttggtgaagaaaaatggaacctgttgtattgcagacttgggacttgctgtgagacatgattctgccacagatacaattgatattgctccaaaccacagagtaggcactaaaaggtacatggcccctgaagttctagatgattccataaatatgaaacattttgaatccttcaaacgcgctgacatctatgcaatgggcttagtgttctgggaaattgctcgacgctgttctattggtggaatccatgaagactatcagttgccttattatgatcttgtaccttctgatccatcggttgaagaaatgagaaaagtagtttgcgaacagaagttaaggccaaatattccaaacagatggcagagctgtgaggccttgagagtgatggctaaaattatgagagaatgctggtatgccaatggagcagcaaggctgacagctttgcgaattaaaaaaacattgtcacaactcagccaacaggaaggcatcaaaatgtaactgaaacaccgtgggaactctgctctcttcatatctgctcctgggtgtttaggaggctggttgttctacctcactgagagaacagagggctctgcttcctcttgcagcagtggaatatggtcaactgaaagcttcccagggtttctctgggcccagaggcagccgtggggtcctttctgtgcactatggatacttcttccagacagttacagaatgttgtgtagtctacttttgtttttattaacaaagcttgtttttaaagacaactgccagcccttagggagctgctgtgctgttgaccttctgtaagggtgaaggagctggggtgtggcactaaatgaagcacttctgattttcactcctagtagtacattctcagaggactctgaaccactagtgtttccttggttcactttgaatgtactgttctataatttttcaagatcttaaactaacactttaaactctatagtctaaaaaatatgacctcgtggaggcgtgggggcacagttgctccgttgtatttgtgcacagctccttcacactctgaacacaacacaccttcacagtagggttgtgctacaccagtaagtgctacttttgcatctgtctaagtggaaacgaacagaactacttaaaggcggtgttaagtcctgtatcattttcattcaaaaagtttatttttctgagtaacctaaaccttttctgggtttgtttttgttttttgagggtttttgtgatagatgtcattcagtcttcatgcctttctcctacccagatgtgcttgaaccactgaggcaaggctgtagcattgataagcagtgactgccatgcgggaacaccccacaggagcactggagctctgcagttgagacgtttagcctgagtttattttaagaagtgaagtggcactccaaacatgtacagtgctttatggatgtaatcattatggtatacagactccttttgaaaggggaggcttgtctattgccgaaggaaaagttgtatgctgttctgtaagccatttctttttctttatttgatcaaagcagtgttttgttttgttttgatttttcttttttggaaaggaattgcatttaaaattcaaatgtggttaatgttaaataataggcctttttctaggaaggcagatatagttaatatgaatgtacaagtgtaggtgactttcacatgttatgtagctgtaagtatttgtggattctatcttgggaagggtagagttagtggagttttgaggtctcactaccctttgaggaaggcagcttttaattcagtctttttatctcatatgtgcagatcttgcaactgcttgatttacatggtagcaatgaattcagtgccacgttgatactaggagaagcagcaactaatagctattctgagtagaggctctcttcatatattcttggtcatattaaatgtcaaagtcagtccgttgggtcttctcactgctgctggagttaggtggttgagcctgggttttacttcagtgctgtcaaatctttgcagggcttgtgtggctttcaaagtcctttttatcactgtgatcatattctgggcggggaaatgttatcatcattgcttgagacgagatgttgaacatagtgataccaatccccagataaaaaggtcaaaataacctttagtgtttagccaagaagagattgtgactattgatctgaagcagctgggctctgttaatgtcttatttcaaacctagcatacatttgaagactatttggtcttaaaccaaagtaactgtaggacgaatgacatactacctagacattagtgtccgtttcatacgtcagaaacaccatgggaaaaagtacctagagattagtatctttaatacaaatctgagttttttctgtaattatcatgatttcatcaatgtaagtaagggtttgttgttacagttgtatcacctgcttaaataagctcttgtgctataatcaggtacttttggggcctttgttttcagttttttccatttctaacccttcgagatctgctttatagaaatccagggaccaatgtattttatcactaaaactgtttttatataattttaagaccataccaaaagttatctgagttaaagttgtaatacgtttcttactttcttgcaaggaaatgggtttttactgaagacacttctcatgatatctgaagttgaagaatcattatgtttttcttacctaagtggataaaatgtgctttgatgaatcagggaattttttaaagttcgaatttagttctaaattgagtttacatgtttacagctaattttttgtgtagggatagtttgattctctaggtggccaatactgaatataaaaataacttaaaaattgagataggtcatggttaatgtggctataactatatatacatctaattagagaaatatttctatgtaattttgtagtgcagtctgttgtttctattgccaatcaaagacttccccccagccccaaagtgtagtatggctaagacatatcttctgacaaattacatattatcttgtcaataccctggttaagctagcatgaaggaagtatgacttactgaggcttacacaacttgagtcccttatatcttcagctctgtttttcccactctgcctttctgctgccccctggctcagagacttagtgttcctgaccccacctccagcctttggacctaagagctgcttttgagacctaaaatgaagtgattgatggaagctgtgtgacatttttccacttccttgagtcactgggtgttatgagggagtgatctgcaaattggggtagggggtgcccctactggtagccctgctttgatgtcagctctgggcaaagattagggtgacagctaagtggcagtggaagttggcctcagaagtagtggccagctgtgtctctagtaggacagtaaaggcatgaagctcagcctgtaatcctgctactacagtagtactccagaagtgccttgaggccctgtgtggggctgtggccatcaagaattccagattttggttctcgctgcagacttaagtggccatgtagccatttttgtaatccatacatgtttgactcttccctctgcaaattgtcagatacgtaaaaccaatgacaaactactacttaacatgcacaccaaaatctgcccagaagacattgtgatttcattccatgcactgaaggaatgattgtaaatcatttctttgttccttggtcatgggagtgttctggttctacattgtggagattccagctgttgttctgttatagcccagcagaacaagtcgacgtgttgaaattctgaagaatagtttgggagtgcagtacagcttcatgtgttggatgttgaaactttcatgggccctctttagaaaagcagaggactgtcagcacattatttttaatcctgttatgcactcgtacttattgtcagtaacaataagtacgagtattgaaaatattgtcagtaacattcagtctctttcttaaagtgaatttgcttatttttcaatgagatttgtgagtttaatattatgaactgtgttttgataatccctttttcacattgtgccaatggaatggaatatttgatatttctttatatgtcaaggagatgcttcaatatgtcatttgctttaaacttaaattacctctcaagagaccaaggtacatttacctcattgtgtatataatgtttaatatttgtcagcatccaccaggtttgcaattttatttctataaagtgtgagtgttacgttgctaagttactcagatggtactgtattgtttatatctgtaccccaaatgacatcatctagactttgttttctgtgtcttattgtatttgtgcagtcctttaaccctgttggtgtgattgctgccctttcagatatgtgcaggtgtctatagaaattctcatttaaggtgaatggttttgagaaacctgtgaagagagaagcataaactgcatttccccatcagttttttaaatgtacattgtatgtgtagtaatattccagatgaattgtaaataaaagctagggagatgcttaaatttcatcctaacactacagtagaaaatggaagcaatgcaaataaacaactttttcccacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]