GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 00:41:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_009095                733 bp    mRNA    linear   ROD 08-AUG-2023
DEFINITION  Mus musculus ribosomal protein S5 (Rps5), transcript variant 2,
            mRNA.
ACCESSION   NM_009095
VERSION     NM_009095.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 733)
  AUTHORS   Li H, Huo Y, He X, Yao L, Zhang H, Cui Y, Xiao H, Xie W, Zhang D,
            Wang Y, Zhang S, Tu H, Cheng Y, Guo Y, Cao X, Zhu Y, Jiang T, Guo
            X, Qin Y and Sha J.
  TITLE     A male germ-cell-specific ribosome controls male fertility
  JOURNAL   Nature 612 (7941), 725-731 (2022)
   PUBMED   36517592
REFERENCE   2  (bases 1 to 733)
  AUTHORS   Harnett D, Ambrozkiewicz MC, Zinnall U, Rusanova A, Borisova E,
            Drescher AN, Couce-Iglesias M, Villamil G, Dannenberg R, Imami K,
            Munster-Wandowski A, Fauler B, Mielke T, Selbach M, Landthaler M,
            Spahn CMT, Tarabykin V, Ohler U and Kraushar ML.
  TITLE     A critical period of translational control during brain development
            at codon resolution
  JOURNAL   Nat Struct Mol Biol 29 (12), 1277-1290 (2022)
   PUBMED   36482253
REFERENCE   3  (bases 1 to 733)
  AUTHORS   Zhang M, Chen D, Xia J, Han W, Cui X, Neuenkirchen N, Hermes G,
            Sestan N and Lin H.
  TITLE     Post-transcriptional regulation of mouse neurogenesis by Pumilio
            proteins
  JOURNAL   Genes Dev 31 (13), 1354-1369 (2017)
   PUBMED   28794184
REFERENCE   4  (bases 1 to 733)
  AUTHORS   Vizirianakis IS, Papachristou ET, Andreadis P, Zopounidou E,
            Matragkou CN and Tsiftsoglou AS.
  TITLE     Genetic manipulation of RPS5 gene expression modulates the
            initiation of commitment of MEL cells to erythroid maturation:
            Implications in understanding ribosomopathies
  JOURNAL   Int J Oncol 47 (1), 303-314 (2015)
   PUBMED   25998414
  REMARK    GeneRIF: Findings support the concept that genetic manipulation of
            RPS5 gene expression level (up- and/or downregulation) critically
            affects the potential of murine erythroleukemia cells to fully
            complete their erythroid maturation program in vitro.
REFERENCE   5  (bases 1 to 733)
  AUTHORS   Khatter H, Myasnikov AG, Natchiar SK and Klaholz BP.
  TITLE     Structure of the human 80S ribosome
  JOURNAL   Nature 520 (7549), 640-645 (2015)
   PUBMED   25901680
REFERENCE   6  (bases 1 to 733)
  AUTHORS   Stryke D, Kawamoto M, Huang CC, Johns SJ, King LA, Harper CA, Meng
            EC, Lee RE, Yee A, L'Italien L, Chuang PT, Young SG, Skarnes WC,
            Babbitt PC and Ferrin TE.
  TITLE     BayGenomics: a resource of insertional mutations in mouse embryonic
            stem cells
  JOURNAL   Nucleic Acids Res 31 (1), 278-281 (2003)
   PUBMED   12520002
REFERENCE   7  (bases 1 to 733)
  AUTHORS   Reymond A, Marigo V, Yaylaoglu MB, Leoni A, Ucla C, Scamuffa N,
            Caccioppoli C, Dermitzakis ET, Lyle R, Banfi S, Eichele G,
            Antonarakis SE and Ballabio A.
  TITLE     Human chromosome 21 gene expression atlas in the mouse
  JOURNAL   Nature 420 (6915), 582-586 (2002)
   PUBMED   12466854
REFERENCE   8  (bases 1 to 733)
  AUTHORS   Pfisterer P, Ehlermann J, Hegen M and Schorle H.
  TITLE     A subtractive gene expression screen suggests a role of
            transcription factor AP-2 alpha in control of proliferation and
            differentiation
  JOURNAL   J Biol Chem 277 (8), 6637-6644 (2002)
   PUBMED   11741941
REFERENCE   9  (bases 1 to 733)
  AUTHORS   Vizirianakis IS, Pappas IS, Gougoumas D and Tsiftsoglou AS.
  TITLE     Expression of ribosomal protein S5 cloned gene during
            differentiation and apoptosis in murine erythroleukemia (MEL) cells
  JOURNAL   Oncol Res 11 (9), 409-419 (1999)
   PUBMED   10821535
REFERENCE   10 (bases 1 to 733)
  AUTHORS   Vanegas N, Castaneda V, Santamaria D, Hernandez P, Schvartzman JB
            and Krimer DB.
  TITLE     Cloning, sequencing and expression in MEL cells of a cDNA encoding
            the mouse ribosomal protein S5
  JOURNAL   Biochim Biophys Acta 1357 (1), 1-4 (1997)
   PUBMED   9202169
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC107704.8.
            
            On Mar 1, 2023 this sequence version replaced NM_009095.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CA461462.1, CA787280.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-71                AC107704.8         141288-141358
            72-180              AC107704.8         141943-142051
            181-390             AC107704.8         144362-144571
            391-519             AC107704.8         144707-144835
            520-618             AC107704.8         145366-145464
            619-733             AC107704.8         145542-145656
FEATURES             Location/Qualifiers
     source          1..733
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 7.69 cM"
     gene            1..733
                     /gene="Rps5"
                     /note="ribosomal protein S5"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
     exon            1..71
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            72..180
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     CDS             73..687
                     /gene="Rps5"
                     /note="40S ribosomal protein S5; S5 ribosomal protein"
                     /codon_start=1
                     /product="small ribosomal subunit protein uS7"
                     /protein_id="NP_033121.2"
                     /db_xref="CCDS:CCDS20817.1"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
                     /translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
     misc_feature    73..75
                     /gene="Rps5"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    76..78
                     /gene="Rps5"
                     /note="N-acetylthreonine, in 40S ribosomal protein S5,
                     N-terminally processed.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    112..114
                     /gene="Rps5"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     misc_feature    124..684
                     /gene="Rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(124..126,211..219,223..234,331..333,343..345)
                     /gene="Rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    211..213
                     /gene="Rps5"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    order(223..225,229..231,241..252,259..261,283..285,
                     292..294,298..312,322..336,343..345,463..471,475..477,
                     505..507,526..528,547..549,556..558,574..579)
                     /gene="Rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(355..357,364..369,376..378,574..576,580..585)
                     /gene="Rps5"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(460..462,469..471,475..477,682..684)
                     /gene="Rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    496..498
                     /gene="Rps5"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     exon            181..390
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            391..519
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            520..618
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            619..733
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]