LOCUS       NM_008887               1609 bp    mRNA    linear   ROD 04-MAR-2025
DEFINITION  Mus musculus paired-like homeobox 2a (Phox2a), mRNA.
ACCESSION   NM_008887
VERSION     NM_008887.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1609)
  AUTHORS   Cao,R., Liu,Y., Wei,K., Jin,N., Liang,Y., Ao,R., Pan,W., Wang,X.,
            Wang,X., Zhang,L. and Xie,J.
  TITLE     Genes related to neural tube defects and glioblastoma
  JOURNAL   Sci Rep 15 (1), 3777 (2025)
   PUBMED   39885289
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1609)
  AUTHORS   Vermeiren,S., Cabochette,P., Dannawi,M., Desiderio,S., San
            Jose,A.S., Achouri,Y., Kricha,S., Sitte,M., Salinas-Riester,G.,
            Vanhollebeke,B., Brunet,J.F. and Bellefroid,E.J.
  TITLE     Prdm12 represses the expression of the visceral neuron determinants
            Phox2a/b in developing somatosensory ganglia
  JOURNAL   iScience 26 (12), 108364 (2023)
   PUBMED   38025786
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1609)
  AUTHORS   Zhang,X., Millecamps,M. and Kania,A.
  TITLE     Genetic evidence of the function of Phox2a-expressing anterolateral
            system neurons in the transmission of chronic pain
  JOURNAL   Mol Pain 19, 17448069231170546 (2023)
   PUBMED   37015885
  REMARK    GeneRIF: Genetic evidence of the function of Phox2a-expressing
            anterolateral system neurons in the transmission of chronic pain.
REFERENCE   4  (bases 1 to 1609)
  AUTHORS   Rastegar-Pouyani,S., Kennedy,T.E. and Kania,A.
  TITLE     Somatotopy of Mouse Spinothalamic Innervation and the Localization
            of a Noxious Stimulus Requires Deleted in Colorectal Carcinoma
            Expression by Phox2a Neurons
  JOURNAL   J Neurosci 42 (42), 7885-7899 (2022)
   PUBMED   36028316
REFERENCE   5  (bases 1 to 1609)
  AUTHORS   Xu,P., He,H., Gao,Q., Zhou,Y., Wu,Z., Zhang,X., Sun,L., Hu,G.,
            Guan,Q., You,Z., Zhang,X., Zheng,W., Xiong,M. and Chen,Y.
  TITLE     Human midbrain dopaminergic neuronal differentiation markers
            predict cell therapy outcomes in a Parkinson's disease model
  JOURNAL   J Clin Invest 132 (14) (2022)
   PUBMED   35700056
REFERENCE   6  (bases 1 to 1609)
  AUTHORS   Morin,X., Cremer,H., Hirsch,M.R., Kapur,R.P., Goridis,C. and
            Brunet,J.F.
  TITLE     Defects in sensory and autonomic ganglia and absence of locus
            coeruleus in mice deficient for the homeobox gene Phox2a
  JOURNAL   Neuron 18 (3), 411-423 (1997)
   PUBMED   9115735
REFERENCE   7  (bases 1 to 1609)
  AUTHORS   Tiveron,M.C., Hirsch,M.R. and Brunet,J.F.
  TITLE     The expression pattern of the transcription factor Phox2 delineates
            synaptic pathways of the autonomic nervous system
  JOURNAL   J Neurosci 16 (23), 7649-7660 (1996)
   PUBMED   8922421
REFERENCE   8  (bases 1 to 1609)
  AUTHORS   Johnson,K.R., Smith,L., Johnson,D.K., Rhodes,J., Rinchik,E.M.,
            Thayer,M. and Lewis,E.J.
  TITLE     Mapping of the ARIX homeodomain gene to mouse chromosome 7 and
            human chromosome 11q13
  JOURNAL   Genomics 33 (3), 527-531 (1996)
   PUBMED   8661014
REFERENCE   9  (bases 1 to 1609)
  AUTHORS   Durbec,P.L., Larsson-Blomberg,L.B., Schuchardt,A., Costantini,F.
            and Pachnis,V.
  TITLE     Common origin and developmental dependence on c-ret of subsets of
            enteric and sympathetic neuroblasts
  JOURNAL   Development 122 (1), 349-358 (1996)
   PUBMED   8565847
REFERENCE   10 (bases 1 to 1609)
  AUTHORS   Valarche,I., Tissier-Seta,J.P., Hirsch,M.R., Martinez,S.,
            Goridis,C. and Brunet,J.F.
  TITLE     The mouse homeodomain protein Phox2 regulates Ncam promoter
            activity in concert with Cux/CDP and is a putative determinant of
            neurotransmitter phenotype
  JOURNAL   Development 119 (3), 881-896 (1993)
   PUBMED   7910552
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CJ058587.1, CJ133172.1 and AC159005.3.
            
            On Nov 1, 2007 this sequence version replaced NM_008887.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X75014.1, CJ133172.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849376, SAMN00849377
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-437               CJ058587.1         2-438
            438-679             CJ133172.1         188-429
            680-1609            AC159005.3         34251-35180         c
FEATURES             Location/Qualifiers
     source          1..1609
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 54.66 cM"
     gene            1..1609
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="paired-like homeobox 2a"
                     /db_xref="GeneID:11859"
                     /db_xref="MGI:MGI:106633"
     exon            1..402
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /inference="alignment:Splign:2.1.0"
     CDS             186..1028
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="PHOX2A homeodomain protein; aristaless homeobox
                     protein homolog; paired mesoderm homeobox 2a; aristaless
                     homeobox gene homolog"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2A"
                     /protein_id="NP_032913.1"
                     /db_xref="CCDS:CCDS21514.1"
                     /db_xref="GeneID:11859"
                     /db_xref="MGI:MGI:106633"
                     /translation="

MDYSYLNSYDSCVAAMEASAYGDFGACSQPGGFQYSPLRPAFPAAGPPCPALGSSNCALGALRDHQPAPYSAVPYKFFPEPSGLHEKRKQRRIRTTFTSAQLKELERVFAETHYPDIYTREELALKIDLTEARVQVWFQNRRAKFRKQERAASAKGAAGATGAKKGEARCSSEDDDSKESTCSPTPDSTASLPPPPAPSLASPRLSPSPLPAALGSGPGPQPLKGALWAGVAGGGGGGPGTGAAELLKAWQPAEPGPGPFSGVLSSFHRKPGPALKTNLF"

     misc_feature    456..626
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    618..917
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62066.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    963..1025
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62066.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            403..590
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /inference="alignment:Splign:2.1.0"
     exon            591..1609
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1584..1589
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="hexamer: AATAAA"
     polyA_site      1609
                     /gene="Phox2a"
                     /gene_synonym="Arix; Phox2; Pmx2; Pmx2a; Px2a"
                     /note="major polyA site"
ORIGIN      

acttgcgttgcaccggggcagagtgcgggccgcgacggggcgggcggactctcgggcgctcagagccggtctcaggtcctctgcgcctggagctcgaatctccatcccgaactccacccagcccgggaccccgaccccaaccagacccggccctgcccggcccccgcccccgccccctcgggccgatggactactcctacctcaattcgtacgattcgtgcgtggcggccatggaggcgtccgcctacggtgacttcggcgcctgcagccagcctggaggcttccaatacagtcccctgcggcctgccttccccgccgctgggccaccttgccccgcgctcggctcctccaactgtgcgcttggcgccctacgcgaccaccagcccgcaccctactcggcagttccctacaagttcttcccggagccgtccggcctgcatgagaagcgcaagcagcggcgcatccgcacaacgttcacgagtgctcagctcaaggagttggagcgcgtcttcgccgagacccactaccccgacatttacactcgcgaggaactggcgctcaagatcgacctcactgaggctcgcgtgcaggtctggttccagaaccgccgggccaagttccgcaaacaggagcgcgcggccagcgccaaaggcgcggcgggagcgacgggcgccaaaaagggcgaggcgcgttgctcgtcggaggacgacgactccaaggagtccacgtgcagccccacgcccgacagcaccgcgtcgctgccgccgccgcctgcacccagcctggccagcccgcgtctgagccccagccctctgcccgccgcgctgggctccgggcccgggccccagccgctcaagggagcgttgtgggcaggggtggcgggcggtggaggtggcggccccggcacgggcgcagcggagctgcttaaggcctggcagccggcggaacccgggccaggtcccttctctggagttctgtcctcctttcaccggaagcccggccccgccctgaagacaaacctcttctagccgcgggcgtctgtaggcaaccagcctgccccgagagagacacccctccccttctggacctggcattatccctccctatcccggcagcctgcctggaaactccccgtcgtccccactacccagtgtctgatccctagacctggccccccttcgtggtaaaacaagccagggccactctggtctggagtactaatcaccgtgccgccccttcagggcggccggaagccctttcttgctaggctttcttaggaacagggatcaaattacacctgtccctcactcagtgcccaatcataaagggtcctaagaagccgagccaacagctcctagacttttcagctagctgggccactcattccttgaaatcaagcaacctgaagagtcccaccgccaatcccacccttaacgagtcacctcccatccctagccagtatggcgcagaggttagacactagaggggaagagccgtcggggaacggaacaaaatggttttccttttcctttattttttctttgaaaaacgtgtaatttattaaggtgattttgctcaatccaaataaaacttaatttattgaagacaa

//