LOCUS       NM_001317729            5156 bp    mRNA    linear   ROD 07-JAN-2025
DEFINITION  Mus musculus aquaporin 4 (Aqp4), transcript variant 1, mRNA.
ACCESSION   NM_001317729
VERSION     NM_001317729.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 5156)
  AUTHORS   Ide,H., Miike,K., Ohmori,T., Maruyama,K., Izumi,Y., Tanigawa,S. and
            Nishinakamura,R.
  TITLE     Mouse embryonic kidney transplantation identifies maturation
            defects in the medulla
  JOURNAL   Sci Rep 14 (1), 30293 (2024)
   PUBMED   39639083
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 5156)
  AUTHORS   Xing,X. and Zhang,S.
  TITLE     Neuroprotective Role of AQP4 Knockdown in Astrocytes After
            Oxygen-Glucose Deprivation
  JOURNAL   Brain Behav 14 (10), e70107 (2024)
   PUBMED   39444081
  REMARK    GeneRIF: Neuroprotective Role of AQP4 Knockdown in Astrocytes After
            Oxygen-Glucose Deprivation.
REFERENCE   3  (bases 1 to 5156)
  AUTHORS   Loughran,G., Chou,M.Y., Ivanov,I.P., Jungreis,I., Kellis,M.,
            Kiran,A.M., Baranov,P.V. and Atkins,J.F.
  TITLE     Evidence of efficient stop codon readthrough in four mammalian
            genes
  JOURNAL   Nucleic Acids Res 42 (14), 8928-8938 (2014)
   PUBMED   25013167
REFERENCE   4  (bases 1 to 5156)
  AUTHORS   Badaut,J., Ashwal,S., Adami,A., Tone,B., Recker,R., Spagnoli,D.,
            Ternon,B. and Obenaus,A.
  TITLE     Brain water mobility decreases after astrocytic aquaporin-4
            inhibition using RNA interference
  JOURNAL   J Cereb Blood Flow Metab 31 (3), 819-831 (2011)
   PUBMED   20877385
  REMARK    GeneRIF: results demonstrate that apparent diffusion coefficient
            values in normal brain are modulated by astrocytic AQP4; suggest
            imaging changes seen in acute neurologic disorders such as stroke
            and trauma are in part due to changes in tissue AQP4 levels
REFERENCE   5  (bases 1 to 5156)
  AUTHORS   Beier,H. and Grimm,M.
  TITLE     Misreading of termination codons in eukaryotes by natural nonsense
            suppressor tRNAs
  JOURNAL   Nucleic Acids Res 29 (23), 4767-4782 (2001)
   PUBMED   11726686
  REMARK    Review article
REFERENCE   6  (bases 1 to 5156)
  AUTHORS   Zelenin,S., Gunnarson,E., Alikina,T., Bondar,A. and Aperia,A.
  TITLE     Identification of a new form of AQP4 mRNA that is developmentally
            expressed in mouse brain
  JOURNAL   Pediatr Res 48 (3), 335-339 (2000)
   PUBMED   10960499
REFERENCE   7  (bases 1 to 5156)
  AUTHORS   Ishida,N., Hirai,S.I. and Mita,S.
  TITLE     Immunolocalization of aquaporin homologs in mouse lacrimal glands
  JOURNAL   Biochem Biophys Res Commun 238 (3), 891-895 (1997)
   PUBMED   9325187
REFERENCE   8  (bases 1 to 5156)
  AUTHORS   Ma,T., Yang,B., Gillespie,A., Carlson,E.J., Epstein,C.J. and
            Verkman,A.S.
  TITLE     Generation and phenotype of a transgenic knockout mouse lacking the
            mercurial-insensitive water channel aquaporin-4
  JOURNAL   J Clin Invest 100 (5), 957-962 (1997)
   PUBMED   9276712
REFERENCE   9  (bases 1 to 5156)
  AUTHORS   Turtzo,L.C., Lee,M.D., Lu,M., Smith,B.L., Copeland,N.G.,
            Gilbert,D.J., Jenkins,N.A. and Agre,P.
  TITLE     Cloning and chromosomal localization of mouse aquaporin 4:
            exclusion of a candidate mutant phenotype, ataxia
  JOURNAL   Genomics 41 (2), 267-270 (1997)
   PUBMED   9143504
REFERENCE   10 (bases 1 to 5156)
  AUTHORS   Ma,T., Yang,B. and Verkman,A.S.
  TITLE     Gene structure, cDNA cloning, and expression of a mouse
            mercurial-insensitive water channel
  JOURNAL   Genomics 33 (3), 382-388 (1996)
   PUBMED   8660998
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF469168.1, U88623.1,
            AK045357.1, BX633380.1, AK079614.1, BB750519.1 and AC133525.2.
            
            Summary: This gene encodes a member of the aquaporin family of
            intrinsic membrane proteins that function as water-selective
            channels in the plasma membranes of many cells. This protein is the
            predominant aquaporin found in brain and has an important role in
            brain water homeostasis. Alternatively spliced transcript variants
            encoding different isoforms have been described for this gene. A
            recent study provided evidence for translational readthrough in
            this gene and expression of an additional C-terminally extended
            isoform via the use of an alternative in-frame translation
            termination codon. [provided by RefSeq, Dec 2015].
            
            Transcript Variant: This variant (1, also known as AQP4.M1 or
            mMIWC2) represents the predominant transcript and encodes two
            isoforms, which result from the use of alternative in-frame
            translation termination codons. The shorter isoform (M1) results
            from translation termination at the upstream UGA stop codon, while
            the longer isoform (M1x) results from UGA stop codon readthrough to
            the downstream UAA termination codon. This RefSeq represents the
            longer, C-terminally extended isoform (M1x). As the UGA stop codon
            has been reported to specify several alternative amino acids
            (tryptophan, cysteine, arginine and serine), its location in the
            longer isoform is denoted by an 'X'.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF469168.1, SRR11927938.3735963.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164131 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            stop codon readthrough :: inferred from conservation
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-261               AF469168.1         1-261
            262-1174            U88623.1           189-1101
            1175-2024           AK045357.1         752-1601
            2025-2025           BX633380.1         202-202             c
            2026-3897           AK045357.1         1602-3473
            3898-5054           AK079614.1         167-1323
            5055-5150           BB750519.1         317-412
            5151-5156           AC133525.2         180919-180924       c
FEATURES             Location/Qualifiers
     source          1..5156
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10090"
                     /chromosome="18"
                     /map="18 8.74 cM"
     gene            1..5156
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="aquaporin 4"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
     exon            1..159
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    62..64
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="upstream in-frame stop codon"
     CDS             128..1186
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="isoform M1x is encoded by transcript variant 1;
                     mercurial-insensitive water channel"
                     /codon_start=1
                     /transl_except=(pos:1097..1099,aa:OTHER)
                     /product="aquaporin-4 isoform M1x"
                     /protein_id="NP_001304658.1"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
                     /translation="

MSDRAAARRWGKCGHSCSRESIMVAFKGVWTQAFWKAVSAEFLATLIFVLLGVGSTINWGGSENPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIIAQCLGAIIGAGILYLVTPPSVVGGLGVTTVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWANHWIYWVGPIMGAVLAGALYEYVFCPDVELKRRLKEAFSKAAQQTKGSYMEVEDNRSQVETEDLILKPGVVHVIDIDRGEEKKGKDSSGEVLSSVXLEDSTEGRRDSLDLASDFLPPIKETDLL"

     misc_feature    194..196
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Region: alternative AUG translation initiation
                     site"
     misc_feature    218..871
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Major intrinsic protein; Region: MIP; pfam00230"
                     /db_xref="CDD:395174"
     misc_feature    order(356..358,410..418,752..757,764..766,773..775)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="amphipathic channel [active]"
                     /db_xref="CDD:238204"
     misc_feature    order(416..424,764..772)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Asn-Pro-Ala signature motifs; other site"
                     /db_xref="CDD:238204"
     exon            160..574
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            575..739
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            740..820
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            821..5156
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    1097..1099
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="upstream translation termination codon, use of
                     which results in the shorter isoform M1"
     regulatory      1100..1103
                     /regulatory_class="recoding_stimulatory_region"
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="stop_codon_readthrough_signal"
                     /function="stimulates stop codon readthrough"
     regulatory      5036..5041
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="hexamer: ATTAAA"
     polyA_site      5054
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="major polyA site"
ORIGIN      

gccacatggtgcagaatctttccacccctactctccaaaaacccaatcagacaagtgcccgtaatctgactcccagtgtactggagcccgggggcaggcactgagctgcactctggccagggaaggcatgagtgacagagctgcggcaaggcggtggggtaagtgtggacattcctgcagtagagagagcatcatggtggctttcaaaggagtctggactcaggctttctggaaggcagtctcagcagaatttctggccacgcttatctttgttttgctcggtgtgggatccaccataaactggggtggctcagaaaaccccttacctgtggacatggtcctcatctccctttgctttggactcagcattgctaccatggtgcagtgctttggccacatcagtggtggccacatcaatcccgctgtgactgtagccatggtgtgcacacgaaagatcagcatcgctaagtccgtcttctacatcattgcacagtgcctgggggccatcattggagccggcatcctctacctggtcacacctcccagtgtggttggaggattgggagtcaccacggttcatggaaacctcaccgctggccatgggctcctggtggagttaataatcactttccagttggtgttcactatttttgccagctgtgattccaaacgaactgatgttactggttcaatagctttagcaattggattttccgttgcaattggacatttgtttgcaatcaattatactggagccagcatgaatccagctcgatcttttggacccgcagttatcatgggaaactgggcaaaccactggatatattgggttggaccaatcatgggcgctgtgctggcaggtgccctttatgagtatgtcttctgtcctgatgtggagctcaaacgtcgccttaaggaagccttcagcaaagccgcgcagcagacaaaagggagctacatggaggtggaggacaaccggagccaagtggagacggaagacttgatcctgaagcccggagtggtgcatgtgattgacattgaccgtggagaagagaagaaggggaaagactcttcgggagaggtattgtcttccgtatgactagaggacagcactgaaggcagaagagactccctagacctggcctcagatttcctgccacccattaaggaaacagatttgttataaattagacacttgcgggtttcttgcttcacaccttgttacacagtttaaataacacatattttactattatcaatggggggggtgagaaaaagcctataatggatataaaattttaaaacagaaatctttttgaatgtatccccaaagcaactatgcaactagtgtattggcttccctttcattaataactgaaattatgaaccaagatctggtcaagttttgccgtgcagagcatatggacacctctgtgaggaagctggcattgtccatcgtcttgactattgacttcattggattgatttaaaaatgacaaaatgcagtatgtcacagaatcatgtgcattcaggagaagacatgcagtaacttcttccacgagctattccttatttataaactacctcggagggggaaaacattagcaagggccattgctaatacatcatttgtatttatatatctgactgtcagaacctaactctaattcactataatcctctccccctcagaatccaagaacccatagggctaaaagtaaaaaaaaaataggaaaaaatattaatttctgtccatgtgttagttccatcaaatgaaagctatacatgggacacccattgaggttcaggacagccagacttgggagtctggtgggaggtggaacaaggtgtgctactgccttgcatccatcacacggagagggaaacctctgttatcaaatgattggtctgttttcagtgcacactcttaaatgtaccacaaaccattaaccacctaagcttttaactatttcactgactttttaaagcttatttgcaaaactggggaatttgtttgccattttgatccctaaatactagcagagacattttagaccagaacttgactagtcgagtcctgacttttagttggtgtctaaatcctgcttactctagctggtataaaccagtcctgccccatcttagctgctgatgctgttttgattcccacgatatgcatcgacaatcggcattgtgagtgtaattatacccatttgtgtgaattaaaatatatgcagacaaggtgcaacgtggttgccaaataaaggggtgagcacacagcctctgtgcaaagctcctagttaccccatctgcacatagcttaccatcatgcttttaaggtatttacctcctgcttggtttatttgttaaaaccatttatttctcccatactgctttgccttccgcccatcgaatgctctgtggaaaccccagtttctatgatcataacagtctagcatagcatttatcttagacaatgtgctgcaaatgtcgatttcagtaaacaaaagttagtagtggaagagagaagagccatttcttcaaggactagcttgtaaatagctggtaatggagggctttcttctcccaagcacaattccaactgtgtgtgacttcttattgttaatggcagttttgtgtctgtggcagcgagataatggaccactattaaacctgattctcttcggtgctaggaaactgatgtgtgagttcccagaaaggcacgagggcagcatatgcctctcggtgccatggtcatgttctgaggcagatgctgggagcatgggccacatttcagggctttgaatatactacaccagagacataagcttcctctctgagcagatcacgcagaaccagggcatagacctcccaggggaggtttctgccgattctttcaaatgttttcacaatataccacgcagacttaagatcagagcgcttcagttcggaaggtgatatcaaccatcaacaaatatgtcgggtcaaaaataaatttacttaacaaggaatagttaagcacatttctgattactctttcaaaatcctggcctgtgattatttttattatgctagacagcttgcttcgtttgtgctcactttaacagtcatttccagtgacagcattcagtatggtacaaactgaaaaacagggaatcatagcttagtgatttgtttgctagcagctggcagagtgccaggcacacagtaggcaatcaaaacaagcatgttgtttgaatatatatacatatatacatatatacatatatacatatatacatatatgtgtatatatgattcttatttgggatttaaaataccaataatctcctctaatttttaattttgcccaatatttagtgaaaacataatttttagtgtcatcaataaaagcaacatggacttggaaacaaagagcatatttttacattctactgtttgaaggcagagagtgactacttcacactcttcgtctttgcaatatgtcttgcatttcactcacggctctgccagtaaaaaatgtaatgaaattgtccctttctaatgacatcgatgcagcaggggtctattgccttgtggatgacaccaaattatacaacatattaggagatcggggattttccctttaatcccttcttattaatgaagtgcatagtgccgttcccaagagacagctactgacagatacaccgcacagagatcagagaggaaaaatcaggaagacataaaagatttatacgagccatgaaacaatgccaactgtctgttccctcaggaggagaacacagacacaccacaaatttcaaggtggtccatacactggaaatgtacatacatagtctgtcaaaggagaacagaaggaaatcttttttttttaattttgagcattttttttttcaaatcagagactctgatttttaaatgtgtgtttccattttcttccaaatgttctacccttttatactacaagaaactgtttcctgtagcctaagtcactggtaattttacaacttgttcctgtgatttgccactatcatgagtcctcttccgttcgatcttcagaggggtgtcccaccacagctcggacactgctggccacagctgctccctgatgaagatttcataaggagttggtagtctctgggaaatgggctgatatattagaggtcaatttcaaaaactgcaacatttctcctaggagaatccaggcaatgtgtgcactgctctaaccccactgagaaccctgacatctcaaaatgaagggactaattaaaatggtggcattggtccttgcctggcctttgttgtgtgatgttgacaccttcctcatagatcagaaatctcacagagacactgcctctgtgacaattgaagccagagagccaaacagacaatcttacaaaagccatgagacgctctaatcactaaactacaggatacgtgaacttggaattgtgcaagcatggcctctacttgaaagtggactataacaaaagaaactttatttacctcaacttttctgagttcatgtccaggtgtcaatacttttcagcacaccttaactaacacaaatatttgaaatccaaaattctcagaaagaaatgttaagacgcttaacttcaaaaatcaaaaattgcggatattcacttttggcacataacttccctgaaaacacacaccaaacaaatattaaacaacacatacagtgaacactacatttaagagcagttatattgttactgttttaagtcaaaattcaagagcttaaaaaatgcccaacatatatattccattgcaatgtattcttagattgttttcaggcttgatcaaataaacatggaatttgtggaaatatattttaaaaatctatttatcattttctctcccaattcacaattaacttgcgacttatgaggaactaaaaaaataaaatgaatgcctggttatattcacatttattaactaaatattattccaactttagagttaatgttaaatggatttgaactgtaatggctaatatttggaaaaatctattaaaagtattagcagtgtggctgggttctgtttcttgtgttatatgtcatactattagtatcatacaattaagtcttcaaatgttttaaaaataaaccatatatttgatggtgtttaag

//