2024-06-15 12:04:07, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_001312868 5701 bp mRNA linear ROD 23-APR-2024 DEFINITION Mus musculus transforming growth factor, beta receptor I (Tgfbr1), transcript variant 2, mRNA. ACCESSION NM_001312868 XM_006537756 VERSION NM_001312868.2 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 5701) AUTHORS Mohamed,F.E.Z.A., Dewidar,B., Lin,T., Ebert,M.P., Dooley,S., Meindl-Beinker,N.M. and Hammad,S. TITLE TGFbetaR1 inhibition drives hepatocellular carcinoma proliferation through induction of toll-like-receptor signalling JOURNAL Int J Exp Pathol 105 (2), 64-74 (2024) PUBMED 38328944 REMARK GeneRIF: TGFbetaR1 inhibition drives hepatocellular carcinoma proliferation through induction of toll-like-receptor signalling. REFERENCE 2 (bases 1 to 5701) AUTHORS Lozovska,A., Korovesi,A.G., Dias,A., Lopes,A., Fowler,D.A., Martins,G.G., Novoa,A. and Mallo,M. TITLE Tgfbr1 controls developmental plasticity between the hindlimb and external genitalia by remodeling their regulatory landscape JOURNAL Nat Commun 15 (1), 2509 (2024) PUBMED 38509075 REMARK GeneRIF: Tgfbr1 controls developmental plasticity between the hindlimb and external genitalia by remodeling their regulatory landscape. Publication Status: Online-Only REFERENCE 3 (bases 1 to 5701) AUTHORS Bedolla,A.M., McKinsey,G.L., Ware,K., Santander,N., Arnold,T.D. and Luo,Y. TITLE A comparative evaluation of the strengths and potential caveats of the microglial inducible CreER mouse models JOURNAL Cell Rep 43 (1), 113660 (2024) PUBMED 38217856 REFERENCE 4 (bases 1 to 5701) AUTHORS Pluangnooch,P., Soontrapa,K., Pudgerd,A. and Sridurongrit,S. TITLE Expression of constitutively active TbetaRI leads to attenuation of ovalbumin-induced allergic airway inflammation associated with augmented M2 polarization of alveolar macrophage JOURNAL Respir Investig 62 (1), 90-97 (2024) PUBMED 38007853 REMARK GeneRIF: Expression of constitutively active TbetaRI leads to attenuation of ovalbumin-induced allergic airway inflammation associated with augmented M2 polarization of alveolar macrophage. REFERENCE 5 (bases 1 to 5701) AUTHORS Alsamraae,M., Costanzo-Garvey,D., Teply,B.A., Boyle,S., Sommerville,G., Herbert,Z.T., Morrissey,C., Dafferner,A.J., Abdalla,M.Y., Fallet,R.W., Kielian,T., Jensen-Smith,H., deOliveira,E.I., Chen,K., Bettencourt,I.A., Wang,J.M., McVicar,D.W., Keeley,T., Yu,F. and Cook,L.M. TITLE Androgen receptor inhibition suppresses anti-tumor neutrophil response against bone metastatic prostate cancer via regulation of TbetaRI expression JOURNAL Cancer Lett 579, 216468 (2023) PUBMED 37940068 REFERENCE 6 (bases 1 to 5701) AUTHORS Iseki,S., Osumi-Yamashita,N., Miyazono,K., Franzen,P., Ichijo,H., Ohtani,H., Hayashi,Y. and Eto,K. TITLE Localization of transforming growth factor-beta type I and type II receptors in mouse development JOURNAL Exp Cell Res 219 (2), 339-347 (1995) PUBMED 7641785 REFERENCE 7 (bases 1 to 5701) AUTHORS Roelen,B.A., Lin,H.Y., Knezevic,V., Freund,E. and Mummery,C.L. TITLE Expression of TGF-beta s and their receptors during implantation and organogenesis of the mouse embryo JOURNAL Dev Biol 166 (2), 716-728 (1994) PUBMED 7813789 REFERENCE 8 (bases 1 to 5701) AUTHORS ten Dijke,P., Yamashita,H., Ichijo,H., Franzen,P., Laiho,M., Miyazono,K. and Heldin,C.H. TITLE Characterization of type I receptors for transforming growth factor-beta and activin JOURNAL Science 264 (5155), 101-104 (1994) PUBMED 8140412 REFERENCE 9 (bases 1 to 5701) AUTHORS Suzuki,A., Shioda,N., Maeda,T., Tada,M. and Ueno,N. TITLE A mouse TGF-beta type I receptor that requires type II receptor for ligand binding JOURNAL Biochem Biophys Res Commun 198 (3), 1063-1069 (1994) PUBMED 8117262 REFERENCE 10 (bases 1 to 5701) AUTHORS Tomoda,T., Kudoh,T., Noma,T., Nakazawa,A., Muramatsu,M. and Arai,K. TITLE Molecular cloning of a mouse counterpart for human TGF-beta type I receptor JOURNAL Biochem Biophys Res Commun 198 (3), 1054-1062 (1994) PUBMED 8117261 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL772232.18 and AL772150.11. On Oct 16, 2023 this sequence version replaced NM_001312868.1. Summary: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR13948564.3676856.1, SRR9219381.91597.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-139 AL772232.18 138526-138664 140-385 AL772150.11 13850-14095 386-616 AL772150.11 23360-23590 617-847 AL772150.11 26456-26686 848-1015 AL772150.11 32904-33071 1016-1172 AL772150.11 33471-33627 1173-1297 AL772150.11 35630-35754 1298-1428 AL772150.11 37023-37153 1429-5701 AL772150.11 40753-45025 FEATURES Location/Qualifiers source 1..5701 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="4" /map="4 26.02 cM" gene 1..5701 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="transforming growth factor, beta receptor I" /db_xref="GeneID:21812" /db_xref="MGI:MGI:98728" exon 1..139 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" CDS 55..1554 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /EC_number="2.7.11.30" /note="isoform 2 precursor is encoded by transcript variant 2; TGF-beta receptor type-1; TGF-beta receptor type I; transforming growth factor-beta receptor type I" /codon_start=1 /product="TGF-beta receptor type-1 isoform 2 precursor" /protein_id="NP_001299797.1" /db_xref="CCDS:CCDS84728.1" /db_xref="GeneID:21812" /db_xref="MGI:MGI:98728" /translation="
MEAAAAAPRRPQLLIVLVAAATLLPGAKALQCFCHLCTKDNFTCETDGLCFVSVTETTDKVIHNSMCIAEIDLIPRDRPFVCAPSSKTGAVTTTYCCNQDHCNKIELPTTEKQSAGLGPVELAAVIAGPVCFVCIALMLMVYICHNRTVIHHRVPNEEDPSLDRPFISEGTTLKDLIYDMTTSGSGSGLPLLVQRTIARTIVLQESIGKGRFGEVWRGKWRGEEVAVKIFSSREERSWFREAEIYQTVMLRHENILGFIAADNKDNGTWTQLWLVSDYHEHGSLFDYLNRYTVTVEGMIKLALSTASGLAHLHMEIVGTQGKPAIAHRDLKSKNILVKKNGTCCIADLGLAVRHDSATDTIDIAPNHRVGTKRYMAPEVLDDSINMKHFESFKRADIYAMGLVFWEIARRCSIGGIHEDYQLPYYDLVPSDPSVEEMRKVVCEQKLRPNIPNRWQSCEALRVMAKIMRECWYANGAARLTALRIKKTLSQLSQQEGIKM"
sig_peptide 55..141 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="COORDINATES: ab initio prediction:SignalP:6.0" misc_feature 142..366 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="extracellular domain (ECD) found in activin receptor-like kinase 5 (ALK-5) and similar proteins; Region: TFP_LU_ECD_ALK5; cd23537" /db_xref="CDD:467067" misc_feature 175..177 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q64729.1); glycosylation site" misc_feature 421..483 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="propagated from UniProtKB/Swiss-Prot (Q64729.1); transmembrane region" misc_feature 535..537 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 568..651 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Transforming growth factor beta type I GS-motif; Region: TGF_beta_GS; pfam08515" /db_xref="CDD:462503" misc_feature 595..597 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphothreonine, by TGFBR2. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 598..600 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphothreonine, by TGFBR2. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 601..603 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphoserine, by TGFBR2. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 607..609 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphoserine, by TGFBR2. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 613..615 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Phosphoserine, by TGFBR2. /evidence=ECO:0000250|UniProtKB:P36897; propagated from UniProtKB/Swiss-Prot (Q64729.1); phosphorylation site" misc_feature 619..624 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="propagated from UniProtKB/Swiss-Prot (Q64729.1); Region: FKBP1A-binding" misc_feature 667..1530 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="Catalytic domain of the Serine/Threonine Kinases, Transforming Growth Factor beta Type I Receptor and Activin Type IB/IC Receptors; Region: STKc_TGFbR1_ACVR1b_ACVR1c; cd14143" /db_xref="CDD:271045" misc_feature order(673..687,697..699,730..732,736..738,820..822, 880..891,901..903,907..909,1039..1041,1045..1047, 1051..1056,1060..1062,1093..1095,1102..1104,1162..1173) /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="active site" /db_xref="CDD:271045" misc_feature order(673..693,697..699,730..732,736..738,880..885, 889..891,901..903,1051..1056,1060..1062,1093..1095) /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271045" misc_feature order(685..687,901..903,907..909,1039..1041,1045..1047, 1051..1053,1102..1104,1162..1173) /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:271045" misc_feature order(766..771,778..783,790..795,835..837,841..843) /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="FKBP12 binding site [polypeptide binding]; other site" /db_xref="CDD:271045" misc_feature 1090..1173 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="activation loop (A-loop); other site" /db_xref="CDD:271045" exon 140..385 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 386..616 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 617..847 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 848..1015 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 1016..1172 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 1173..1297 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 1298..1428 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" exon 1429..5701 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /inference="alignment:Splign:2.1.0" regulatory 5680..5685 /regulatory_class="polyA_signal_sequence" /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="hexamer: AATAAA" polyA_site 5701 /gene="Tgfbr1" /gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI; TGFR-1" /note="major polyA site" ORIGIN
gaggagaagctgcggccggggccgggccgggccacaaacagtggcggcgggaccatggaggcggcggccgctgctccacgtcgtccgcagctcctcatcgtgttggtggcggcggcgacgctgctcccgggggcgaaggcattacagtgtttctgccacctctgtacaaaggataattttacctgtgagacagatggtctttgctttgtctcagtcactgagaccacagacaaagttatacacaatagtatgtgtatagctgaaattgacctaattcctcgagacaggccatttgtatgtgcaccatcttcaaaaacaggggcagttactacaacatattgctgcaatcaggaccactgcaataaaatagaactcccaactacagaaaagcagtcagctggccttggtcctgtggagctggcagctgtcattgctggtccagtctgcttcgtctgcattgcacttatgctgatggtctatatctgccataaccgcactgtcattcaccaccgtgtgccaaatgaagaggatccatcactagatcgccctttcatttcagagggcaccaccttaaaagatttaatttatgatatgacaacatcagggtctggatcaggtttaccactgcttgttcaaagaacaattgccaggaccattgtgttacaagaaagcattggcaaaggtcggtttggagaagtttggcgaggcaaatggcggggagaagaagttgctgtgaagatattctcttctagagaagagcgttcatggttccgagaggcagagatttatcagactgtaatgttacgccatgaaaatatcctgggatttatagcagcagacaacaaagacaatgggacatggacgcagctgtggttggtgtcagattatcatgagcatggatcccttttcgattacttgaatagatacactgttactgtggaaggaatgatcaagcttgctctgtccacagcaagtggtcttgcccatcttcacatggagattgttggtacccaaggaaaaccagctattgcccatagagatttgaaatcaaagaatatcttggtgaagaaaaatggaacctgttgtattgcagacttgggacttgctgtgagacatgattctgccacagatacaattgatattgctccaaaccacagagtaggcactaaaaggtacatggcccctgaagttctagatgattccataaatatgaaacattttgaatccttcaaacgcgctgacatctatgcaatgggcttagtgttctgggaaattgctcgacgctgttctattggtggaatccatgaagactatcagttgccttattatgatcttgtaccttctgatccatcggttgaagaaatgagaaaagtagtttgcgaacagaagttaaggccaaatattccaaacagatggcagagctgtgaggccttgagagtgatggctaaaattatgagagaatgctggtatgccaatggagcagcaaggctgacagctttgcgaattaaaaaaacattgtcacaactcagccaacaggaaggcatcaaaatgtaactgaaacaccgtgggaactctgctctcttcatatctgctcctgggtgtttaggaggctggttgttctacctcactgagagaacagagggctctgcttcctcttgcagcagtggaatatggtcaactgaaagcttcccagggtttctctgggcccagaggcagccgtggggtcctttctgtgcactatggatacttcttccagacagttacagaatgttgtgtagtctacttttgtttttattaacaaagcttgtttttaaagacaactgccagcccttagggagctgctgtgctgttgaccttctgtaagggtgaaggagctggggtgtggcactaaatgaagcacttctgattttcactcctagtagtacattctcagaggactctgaaccactagtgtttccttggttcactttgaatgtactgttctataatttttcaagatcttaaactaacactttaaactctatagtctaaaaaatatgacctcgtggaggcgtgggggcacagttgctccgttgtatttgtgcacagctccttcacactctgaacacaacacaccttcacagtagggttgtgctacaccagtaagtgctacttttgcatctgtctaagtggaaacgaacagaactacttaaaggcggtgttaagtcctgtatcattttcattcaaaaagtttatttttctgagtaacctaaaccttttctgggtttgtttttgttttttgagggtttttgtgatagatgtcattcagtcttcatgcctttctcctacccagatgtgcttgaaccactgaggcaaggctgtagcattgataagcagtgactgccatgcgggaacaccccacaggagcactggagctctgcagttgagacgtttagcctgagtttattttaagaagtgaagtggcactccaaacatgtacagtgctttatggatgtaatcattatggtatacagactccttttgaaaggggaggcttgtctattgccgaaggaaaagttgtatgctgttctgtaagccatttctttttctttatttgatcaaagcagtgttttgttttgttttgatttttcttttttggaaaggaattgcatttaaaattcaaatgtggttaatgttaaataataggcctttttctaggaaggcagatatagttaatatgaatgtacaagtgtaggtgactttcacatgttatgtagctgtaagtatttgtggattctatcttgggaagggtagagttagtggagttttgaggtctcactaccctttgaggaaggcagcttttaattcagtctttttatctcatatgtgcagatcttgcaactgcttgatttacatggtagcaatgaattcagtgccacgttgatactaggagaagcagcaactaatagctattctgagtagaggctctcttcatatattcttggtcatattaaatgtcaaagtcagtccgttgggtcttctcactgctgctggagttaggtggttgagcctgggttttacttcagtgctgtcaaatctttgcagggcttgtgtggctttcaaagtcctttttatcactgtgatcatattctgggcggggaaatgttatcatcattgcttgagacgagatgttgaacatagtgataccaatccccagataaaaaggtcaaaataacctttagtgtttagccaagaagagattgtgactattgatctgaagcagctgggctctgttaatgtcttatttcaaacctagcatacatttgaagactatttggtcttaaaccaaagtaactgtaggacgaatgacatactacctagacattagtgtccgtttcatacgtcagaaacaccatgggaaaaagtacctagagattagtatctttaatacaaatctgagttttttctgtaattatcatgatttcatcaatgtaagtaagggtttgttgttacagttgtatcacctgcttaaataagctcttgtgctataatcaggtacttttggggcctttgttttcagttttttccatttctaacccttcgagatctgctttatagaaatccagggaccaatgtattttatcactaaaactgtttttatataattttaagaccataccaaaagttatctgagttaaagttgtaatacgtttcttactttcttgcaaggaaatgggtttttactgaagacacttctcatgatatctgaagttgaagaatcattatgtttttcttacctaagtggataaaatgtgctttgatgaatcagggaattttttaaagttcgaatttagttctaaattgagtttacatgtttacagctaattttttgtgtagggatagtttgattctctaggtggccaatactgaatataaaaataacttaaaaattgagataggtcatggttaatgtggctataactatatatacatctaattagagaaatatttctatgtaattttgtagtgcagtctgttgtttctattgccaatcaaagacttccccccagccccaaagtgtagtatggctaagacatatcttctgacaaattacatattatcttgtcaataccctggttaagctagcatgaaggaagtatgacttactgaggcttacacaacttgagtcccttatatcttcagctctgtttttcccactctgcctttctgctgccccctggctcagagacttagtgttcctgaccccacctccagcctttggacctaagagctgcttttgagacctaaaatgaagtgattgatggaagctgtgtgacatttttccacttccttgagtcactgggtgttatgagggagtgatctgcaaattggggtagggggtgcccctactggtagccctgctttgatgtcagctctgggcaaagattagggtgacagctaagtggcagtggaagttggcctcagaagtagtggccagctgtgtctctagtaggacagtaaaggcatgaagctcagcctgtaatcctgctactacagtagtactccagaagtgccttgaggccctgtgtggggctgtggccatcaagaattccagattttggttctcgctgcagacttaagtggccatgtagccatttttgtaatccatacatgtttgactcttccctctgcaaattgtcagatacgtaaaaccaatgacaaactactacttaacatgcacaccaaaatctgcccagaagacattgtgatttcattccatgcactgaaggaatgattgtaaatcatttctttgttccttggtcatgggagtgttctggttctacattgtggagattccagctgttgttctgttatagcccagcagaacaagtcgacgtgttgaaattctgaagaatagtttgggagtgcagtacagcttcatgtgttggatgttgaaactttcatgggccctctttagaaaagcagaggactgtcagcacattatttttaatcctgttatgcactcgtacttattgtcagtaacaataagtacgagtattgaaaatattgtcagtaacattcagtctctttcttaaagtgaatttgcttatttttcaatgagatttgtgagtttaatattatgaactgtgttttgataatccctttttcacattgtgccaatggaatggaatatttgatatttctttatatgtcaaggagatgcttcaatatgtcatttgctttaaacttaaattacctctcaagagaccaaggtacatttacctcattgtgtatataatgtttaatatttgtcagcatccaccaggtttgcaattttatttctataaagtgtgagtgttacgttgctaagttactcagatggtactgtattgtttatatctgtaccccaaatgacatcatctagactttgttttctgtgtcttattgtatttgtgcagtcctttaaccctgttggtgtgattgctgccctttcagatatgtgcaggtgtctatagaaattctcatttaaggtgaatggttttgagaaacctgtgaagagagaagcataaactgcatttccccatcagttttttaaatgtacattgtatgtgtagtaatattccagatgaattgtaaataaaagctagggagatgcttaaatttcatcctaacactacagtagaaaatggaagcaatgcaaataaacaactttttcccacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]