ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-22 18:57:39, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001308642 5272 bp mRNA linear ROD 12-AUG-2025
DEFINITION Mus musculus aquaporin 4 (Aqp4), transcript variant 4, mRNA.
ACCESSION NM_001308642 XM_011246817
VERSION NM_001308642.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 5272)
AUTHORS Lin,S., Dieterich,C., Britto-Borges,T., Gunther,S., Kreher,S.,
Eibach,Y., Kuenne,C., Schneider,A. and Braun,T.
TITLE Rbpms2 prevents major cardiac defects in cardiomyocyte-specific
Rbpms-deficient mice
JOURNAL Dev Cell (2025) In press
PUBMED 40602408
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 5272)
AUTHORS Parvez,R.K., Csipan,R.L., Liu,J., Gevorgyan,A., Rutledge,E.A.,
Guo,J., Kim,D.K. and McMahon,A.P.
TITLE Developmental and Cell Fate Analyses Support a Postnatal Origin for
the Cortical Collecting System in the Mouse Kidney
JOURNAL J Am Soc Nephrol 36 (5), 812-824 (2025)
PUBMED 39665296
REFERENCE 3 (bases 1 to 5272)
AUTHORS Loughran,G., Chou,M.Y., Ivanov,I.P., Jungreis,I., Kellis,M.,
Kiran,A.M., Baranov,P.V. and Atkins,J.F.
TITLE Evidence of efficient stop codon readthrough in four mammalian
genes
JOURNAL Nucleic Acids Res 42 (14), 8928-8938 (2014)
PUBMED 25013167
REFERENCE 4 (bases 1 to 5272)
AUTHORS Badaut,J., Ashwal,S., Adami,A., Tone,B., Recker,R., Spagnoli,D.,
Ternon,B. and Obenaus,A.
TITLE Brain water mobility decreases after astrocytic aquaporin-4
inhibition using RNA interference
JOURNAL J Cereb Blood Flow Metab 31 (3), 819-831 (2011)
PUBMED 20877385
REMARK GeneRIF: results demonstrate that apparent diffusion coefficient
values in normal brain are modulated by astrocytic AQP4; suggest
imaging changes seen in acute neurologic disorders such as stroke
and trauma are in part due to changes in tissue AQP4 levels
REFERENCE 5 (bases 1 to 5272)
AUTHORS Beier,H. and Grimm,M.
TITLE Misreading of termination codons in eukaryotes by natural nonsense
suppressor tRNAs
JOURNAL Nucleic Acids Res 29 (23), 4767-4782 (2001)
PUBMED 11726686
REMARK Review article
REFERENCE 6 (bases 1 to 5272)
AUTHORS Zelenin,S., Gunnarson,E., Alikina,T., Bondar,A. and Aperia,A.
TITLE Identification of a new form of AQP4 mRNA that is developmentally
expressed in mouse brain
JOURNAL Pediatr Res 48 (3), 335-339 (2000)
PUBMED 10960499
REFERENCE 7 (bases 1 to 5272)
AUTHORS Ishida,N., Hirai,S.I. and Mita,S.
TITLE Immunolocalization of aquaporin homologs in mouse lacrimal glands
JOURNAL Biochem Biophys Res Commun 238 (3), 891-895 (1997)
PUBMED 9325187
REFERENCE 8 (bases 1 to 5272)
AUTHORS Ma,T., Yang,B., Gillespie,A., Carlson,E.J., Epstein,C.J. and
Verkman,A.S.
TITLE Generation and phenotype of a transgenic knockout mouse lacking the
mercurial-insensitive water channel aquaporin-4
JOURNAL J Clin Invest 100 (5), 957-962 (1997)
PUBMED 9276712
REFERENCE 9 (bases 1 to 5272)
AUTHORS Turtzo,L.C., Lee,M.D., Lu,M., Smith,B.L., Copeland,N.G.,
Gilbert,D.J., Jenkins,N.A. and Agre,P.
TITLE Cloning and chromosomal localization of mouse aquaporin 4:
exclusion of a candidate mutant phenotype, ataxia
JOURNAL Genomics 41 (2), 267-270 (1997)
PUBMED 9143504
REFERENCE 10 (bases 1 to 5272)
AUTHORS Ma,T., Yang,B. and Verkman,A.S.
TITLE Gene structure, cDNA cloning, and expression of a mouse
mercurial-insensitive water channel
JOURNAL Genomics 33 (3), 382-388 (1996)
PUBMED 8660998
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC133525.2.
On May 15, 2015 this sequence version replaced XM_011246817.1.
Summary: This gene encodes a member of the aquaporin family of
intrinsic membrane proteins that function as water-selective
channels in the plasma membranes of many cells. This protein is the
predominant aquaporin found in brain and has an important role in
brain water homeostasis. Alternatively spliced transcript variants
encoding different isoforms have been described for this gene. A
recent study provided evidence for translational readthrough in
this gene and expression of an additional C-terminally extended
isoform via the use of an alternative in-frame translation
termination codon. [provided by RefSeq, Dec 2015].
Transcript Variant: This variant (4, also known as ad/1) contains
alternate exons at the 5' end, which cause translation initiation
from an in-frame, downstream start codon, compared to variant 1.
The resulting isoform (M23, also known as M23A) has a shorter
N-terminus compared to isoform 1. Variants 2-8 encode the same
isoform.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY484965.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMN00849374,
SAMN00849375 [ECO:0006172]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-91 AC133525.2 202417-202507 c
92-275 AC133525.2 195706-195889 c
276-690 AC133525.2 191113-191527 c
691-855 AC133525.2 189616-189780 c
856-936 AC133525.2 189104-189184 c
937-5272 AC133525.2 180919-185254 c
FEATURES Location/Qualifiers
source 1..5272
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="18"
/map="18 8.74 cM"
gene 1..5272
/gene="Aqp4"
/gene_synonym="WCH4"
/note="aquaporin 4"
/db_xref="GeneID:11829"
/db_xref="MGI:MGI:107387"
exon 1..91
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
exon 92..275
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
misc_feature 187..189
/gene="Aqp4"
/gene_synonym="WCH4"
/note="upstream in-frame stop codon"
exon 276..690
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
CDS 310..1215
/gene="Aqp4"
/gene_synonym="WCH4"
/note="isoform M23 is encoded by transcript variant 4;
mercurial-insensitive water channel"
/codon_start=1
/product="aquaporin-4 isoform M23"
/protein_id="NP_001295571.1"
/db_xref="CCDS:CCDS89196.1"
/db_xref="GeneID:11829"
/db_xref="MGI:MGI:107387"
/translation="
MVAFKGVWTQAFWKAVSAEFLATLIFVLLGVGSTINWGGSENPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIIAQCLGAIIGAGILYLVTPPSVVGGLGVTTVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWANHWIYWVGPIMGAVLAGALYEYVFCPDVELKRRLKEAFSKAAQQTKGSYMEVEDNRSQVETEDLILKPGVVHVIDIDRGEEKKGKDSSGEVLSSV"
misc_feature 334..987
/gene="Aqp4"
/gene_synonym="WCH4"
/note="Major intrinsic protein; Region: MIP; pfam00230"
/db_xref="CDD:395174"
misc_feature order(472..474,526..534,868..873,880..882,889..891)
/gene="Aqp4"
/gene_synonym="WCH4"
/note="amphipathic channel [active]"
/db_xref="CDD:238204"
misc_feature order(532..540,880..888)
/gene="Aqp4"
/gene_synonym="WCH4"
/note="Asn-Pro-Ala signature motifs; other site"
/db_xref="CDD:238204"
exon 691..855
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
exon 856..936
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
exon 937..5272
/gene="Aqp4"
/gene_synonym="WCH4"
/inference="alignment:Splign:2.1.0"
regulatory 5152..5157
/regulatory_class="polyA_signal_sequence"
/gene="Aqp4"
/gene_synonym="WCH4"
/note="hexamer: ATTAAA"
polyA_site 5170
/gene="Aqp4"
/gene_synonym="WCH4"
/note="major polyA site"
ORIGIN
cacaagacctttgctctgggcatcctgtcacaacacacaacatcagcacacactgcccaacgttagctcacgtggaggattatactgtgtcctcactggatggggacagtttcatgggcatgcactcatgcatttggaggagtcctacgctctgctcaactccctgtggtgacaatcttacagtcctgagtaacttatgaggactgtgtcctacactcattcttaacagagaacagcaaagtatatatacagtcctggccccagctttccaaacgtaagtgtggacattcctgcagtagagagagcatcatggtggctttcaaaggagtctggactcaggctttctggaaggcagtctcagcagaatttctggccacgcttatctttgttttgctcggtgtgggatccaccataaactggggtggctcagaaaaccccttacctgtggacatggtcctcatctccctttgctttggactcagcattgctaccatggtgcagtgctttggccacatcagtggtggccacatcaatcccgctgtgactgtagccatggtgtgcacacgaaagatcagcatcgctaagtccgtcttctacatcattgcacagtgcctgggggccatcattggagccggcatcctctacctggtcacacctcccagtgtggttggaggattgggagtcaccacggttcatggaaacctcaccgctggccatgggctcctggtggagttaataatcactttccagttggtgttcactatttttgccagctgtgattccaaacgaactgatgttactggttcaatagctttagcaattggattttccgttgcaattggacatttgtttgcaatcaattatactggagccagcatgaatccagctcgatcttttggacccgcagttatcatgggaaactgggcaaaccactggatatattgggttggaccaatcatgggcgctgtgctggcaggtgccctttatgagtatgtcttctgtcctgatgtggagctcaaacgtcgccttaaggaagccttcagcaaagccgcgcagcagacaaaagggagctacatggaggtggaggacaaccggagccaagtggagacggaagacttgatcctgaagcccggagtggtgcatgtgattgacattgaccgtggagaagagaagaaggggaaagactcttcgggagaggtattgtcttccgtatgactagaggacagcactgaaggcagaagagactccctagacctggcctcagatttcctgccacccattaaggaaacagatttgttataaattagacacttgcgggtttcttgcttcacaccttgttacacagtttaaataacacatattttactattatcaatggggggggtgagaaaaagcctataatggatataaaattttaaaacagaaatctttttgaatgtatccccaaagcaactatgcaactagtgtattggcttccctttcattaataactgaaattatgaaccaagatctggtcaagttttgccgtgcagagcatatggacacctctgtgaggaagctggcattgtccatcgtcttgactattgacttcattggattgatttaaaaatgacaaaatgcagtatgtcacagaatcatgtgcattcaggagaagacatgcagtaacttcttccacgagctattccttatttataaactacctcggagggggaaaacattagcaagggccattgctaatacatcatttgtatttatatatctgactgtcagaacctaactctaattcactataatcctctccccctcagaatccaagaacccatagggctaaaagtaaaaaaaaaataggaaaaaatattaatttctgtccatgtgttagttccatcaaatgaaagctatacatgggacacccattgaggttcaggacagccagacttgggagtctggtgggaggtggaacaaggtgtgctactgccttgcatccatcacacggagagggaaacctctgttatcaaatgattggtctgttttcagtgcacactcttaaatgtaccacaaaccattaaccacctaagcttttaactatttcactgactttttaaagcttatttgcaaaactggggaatttgtttgccattttgatccctaaatactagcagagacattttagaccagaacttgactagtcgagtcctgacttttagttggtgtctaaatcctgcttactctagctggtataaaccagtcctgccccatcttagctgctgatgctgttttgattcccacgatatgcatcgacaatcggcattgtgagtgtaattatacccatttgtgtgaattaaaatatatgcagacaaggtgcaacgtggttgccaaataaaggggtgagcacacagcctctgtgcaaagctcctagttaccccatctgcacatagcttaccatcatgcttttaaggtatttacctcctgcttggtttatttgttaaaaccatttatttctcccatactgctttgccttccgcccatcgaatgctctgtggaaaccccagtttctatgatcataacagtctagcatagcatttatcttagacaatgtgctgcaaatgtcgatttcagtaaacaaaagttagtagtggaagagagaagagccatttcttcaaggactagcttgtaaatagctggtaatggagggctttcttctcccaagcacaattccaactgtgtgtgacttcttattgttaatggcagttttgtgtctgtggcagcgagataatggaccactattaaacctgattctcttcggtgctaggaaactgatgtgtgagttcccagaaaggcacgagggcagcatatgcctctcggtgccatggtcatgttctgaggcagatgctgggagcatgggccacatttcagggctttgaatatactacaccagagacataagcttcctctctgagcagatcacgcagaaccagggcatagacctcccaggggaggtttctgccgattctttcaaatgttttcacaatataccacgcagacttaagatcagagcgcttcagttcggaaggtgatatcaaccatcaacaaatatgtcgggtcaaaaataaatttacttaacaaggaatagttaagcacatttctgattactctttcaaaatcctggcctgtgattatttttattatgctagacagcttgcttcgtttgtgctcactttaacagtcatttccagtgacagcattcagtatggtacaaactgaaaaacagggaatcatagcttagtgatttgtttgctagcagctggcagagtgccaggcacacagtaggcaatcaaaacaagcatgttgtttgaatatatatacatatatacatatatacatatatacatatatacatatatgtgtatatatgattcttatttgggatttaaaataccaataatctcctctaatttttaattttgcccaatatttagtgaaaacataatttttagtgtcatcaataaaagcaacatggacttggaaacaaagagcatatttttacattctactgtttgaaggcagagagtgactacttcacactcttcgtctttgcaatatgtcttgcatttcactcacggctctgccagtaaaaaatgtaatgaaattgtccctttctaatgacatcgatgcagcaggggtctattgccttgtggatgacaccaaattatacaacatattaggagatcggggattttccctttaatcccttcttattaatgaagtgcatagtgccgttcccaagagacagctactgacagatacaccgcacagagatcagagaggaaaaatcaggaagacataaaagatttatacgagccatgaaacaatgccaactgtctgttccctcaggaggagaacacagacacaccacaaatttcaaggtggtccatacactggaaatgtacatacatagtctgtcaaaggagaacagaaggaaatcttttttttttaattttgagcattttttttttcaaatcagagactctgatttttaaatgtgtgtttccattttcttccaaatgttctacccttttatactacaagaaactgtttcctgtagcctaagtcactggtaattttacaacttgttcctgtgatttgccactatcatgagtcctcttccgttcgatcttcagaggggtgtcccaccacagctcggacactgctggccacagctgctccctgatgaagatttcataaggagttggtagtctctgggaaatgggctgatatattagaggtcaatttcaaaaactgcaacatttctcctaggagaatccaggcaatgtgtgcactgctctaaccccactgagaaccctgacatctcaaaatgaagggactaattaaaatggtggcattggtccttgcctggcctttgttgtgtgatgttgacaccttcctcatagatcagaaatctcacagagacactgcctctgtgacaattgaagccagagagccaaacagacaatcttacaaaagccatgagacgctctaatcactaaactacaggatacgtgaacttggaattgtgcaagcatggcctctacttgaaagtggactataacaaaagaaactttatttacctcaacttttctgagttcatgtccaggtgtcaatacttttcagcacaccttaactaacacaaatatttgaaatccaaaattctcagaaagaaatgttaagacgcttaacttcaaaaatcaaaaattgcggatattcacttttggcacataacttccctgaaaacacacaccaaacaaatattaaacaacacatacagtgaacactacatttaagagcagttatattgttactgttttaagtcaaaattcaagagcttaaaaaatgcccaacatatatattccattgcaatgtattcttagattgttttcaggcttgatcaaataaacatggaatttgtggaaatatattttaaaaatctatttatcattttctctcccaattcacaattaacttgcgacttatgaggaactaaaaaaataaaatgaatgcctggttatattcacatttattaactaaatattattccaactttagagttaatgttaaatggatttgaactgtaatggctaatatttggaaaaatctattaaaagtattagcagtgtggctgggttctgtttcttgtgttatatgtcatactattagtatcatacaattaagtcttcaaatgttttaaaaataaaccatatatttgatggtgtttaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]