LOCUS       NM_001184969             648 bp    mRNA    linear   ROD 07-AUG-2023
DEFINITION  Mus musculus reproductive homeobox 3E (Rhox3e), mRNA.
ACCESSION   NM_001184969
VERSION     NM_001184969.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 648)
  AUTHORS   MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and
            Wilkinson,M.F.
  TITLE     Rhox homeobox gene cluster: recent duplication of three family
            members
  JOURNAL   Genesis 44 (3), 122-129 (2006)
   PUBMED   16496311
REFERENCE   2  (bases 1 to 648)
  AUTHORS   Morris L, Gordon J and Blackburn CC.
  TITLE     Identification of a tandem duplicated array in the Rhox alpha locus
            on mouse chromosome X
  JOURNAL   Mamm Genome 17 (2), 178-187 (2006)
   PUBMED   16465597
REFERENCE   3  (bases 1 to 648)
  AUTHORS   Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML,
            Macleod C and Wilkinson MF.
  TITLE     Rhox: a new homeobox gene cluster
  JOURNAL   Cell 120 (3), 369-382 (2005)
   PUBMED   15707895
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL808133.17.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN00849384,
                              SAMN01164134 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-181               AL808133.17        26773-26953
            182-551             AL808133.17        27204-27573
            552-597             AL808133.17        29451-29496
            598-648             AL808133.17        30645-30695
FEATURES             Location/Qualifiers
     source          1..648
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 21.84 cM"
     gene            1..648
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /note="reproductive homeobox 3E"
                     /db_xref="GeneID:100135657"
                     /db_xref="MGI:MGI:3770274"
     CDS             1..648
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /note="reproductive homeobox 3D"
                     /codon_start=1
                     /product="reproductive homeobox 3E"
                     /protein_id="NP_001171898.1"
                     /db_xref="CCDS:CCDS53056.1"
                     /db_xref="GeneID:100135657"
                     /db_xref="MGI:MGI:3770274"
                     /translation="

MSMKPERSISNWIHSNVERAGRNLFQVNGHRSALLPELPQDYHRASRSVNGCETKMDSTQGTKVLPAEEGKNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEAPRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREQYRWYKRL"

     misc_feature    463..633
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(463..477,481..483,532..534,550..552,589..591,
                     595..600,607..612,616..624,628..633)
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(469..471,478..480,598..600,607..612,619..621)
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..181
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /inference="alignment:Splign:2.1.0"
     exon            182..551
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /inference="alignment:Splign:2.1.0"
     exon            552..597
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /inference="alignment:Splign:2.1.0"
     exon            598..648
                     /gene="Rhox3e"
                     /gene_synonym="Rhox3.5; Rhox3d"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgagcatgaagccagaacgttccatctctaactggatacatagtaatgtggaacgggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaaggtcagtcaacggatgtgagactaaaatggacagcacccaaggtaccaaggttttgccggctgaagagggaaaaaatgaagaagatggaggacaggtggagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcgccaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaacaatacaggtggtataagaggctataa

//