2024-04-29 14:17:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001168295 2042 bp mRNA linear ROD 06-AUG-2023 DEFINITION Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3F (Serpina3f), transcript variant 3, mRNA. ACCESSION NM_001168295 VERSION NM_001168295.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2042) AUTHORS Kidoya H, Naito H, Muramatsu F, Yamakawa D, Jia W, Ikawa M, Sonobe T, Tsuchimochi H, Shirai M, Adams RH, Fukamizu A and Takakura N. TITLE APJ Regulates Parallel Alignment of Arteries and Veins in the Skin JOURNAL Dev Cell 33 (3), 247-259 (2015) PUBMED 25920569 REFERENCE 2 (bases 1 to 2042) AUTHORS Heit C, Jackson BC, McAndrews M, Wright MW, Thompson DC, Silverman GA, Nebert DW and Vasiliou V. TITLE Update of the human and mouse SERPIN gene superfamily JOURNAL Hum Genomics 7 (1), 22 (2013) PUBMED 24172014 REMARK Review article Publication Status: Online-Only REFERENCE 3 (bases 1 to 2042) AUTHORS Archambaud C, Nahori MA, Soubigou G, Becavin C, Laval L, Lechat P, Smokvina T, Langella P, Lecuit M and Cossart P. TITLE Impact of lactobacilli on orally acquired listeriosis JOURNAL Proc Natl Acad Sci U S A 109 (41), 16684-16689 (2012) PUBMED 23012479 REFERENCE 4 (bases 1 to 2042) AUTHORS Ghesquiere B, Van Damme J, Martens L, Vandekerckhove J and Gevaert K. TITLE Proteome-wide characterization of N-glycosylation events by diagonal chromatography JOURNAL J Proteome Res 5 (9), 2438-2447 (2006) PUBMED 16944957 REFERENCE 5 (bases 1 to 2042) AUTHORS Winkler IG, Hendy J, Coughlin P, Horvath A and Levesque JP. TITLE Serine protease inhibitors serpina1 and serpina3 are down-regulated in bone marrow during hematopoietic progenitor mobilization JOURNAL J Exp Med 201 (7), 1077-1088 (2005) PUBMED 15795238 REFERENCE 6 (bases 1 to 2042) AUTHORS Horvath AJ, Forsyth SL and Coughlin PB. TITLE Expression patterns of murine antichymotrypsin-like genes reflect evolutionary divergence at the Serpina3 locus JOURNAL J Mol Evol 59 (4), 488-497 (2004) PUBMED 15638460 REFERENCE 7 (bases 1 to 2042) AUTHORS Forsyth S, Horvath A and Coughlin P. TITLE A review and comparison of the murine alpha1-antitrypsin and alpha1-antichymotrypsin multigene clusters with the human clade A serpins JOURNAL Genomics 81 (3), 336-345 (2003) PUBMED 12659817 REMARK Review article REFERENCE 8 (bases 1 to 2042) AUTHORS Inglis JD and Hill RE. TITLE The murine Spi-2 proteinase inhibitor locus: a multigene family with a hypervariable reactive site domain JOURNAL EMBO J 10 (2), 255-261 (1991) PUBMED 1991447 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK150157.1, BC139132.1, AK138954.1 and AC142112.3. Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. ##Evidence-Data-START## Transcript exon combination :: BC049975.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849388, SAMN01164135 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-77 AK150157.1 2-78 78-1246 AK150157.1 291-1459 1247-1825 BC139132.1 1307-1885 1826-2036 AK138954.1 1998-2208 2037-2042 AC142112.3 76336-76341 c FEATURES Location/Qualifiers source 1..2042 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="12" /map="12 53.65 cM" gene 1..2042 /gene="Serpina3f" /gene_synonym="2A1" /note="serine (or cysteine) peptidase inhibitor, clade A, member 3F" /db_xref="GeneID:238393" /db_xref="MGI:MGI:2182838" exon 1..77 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 78..696 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" CDS 90..1427 /gene="Serpina3f" /gene_synonym="2A1" /note="antitrypsin; alpha-1 antiproteinasin; serpin A3F" /codon_start=1 /product="serine protease inhibitor A3F" /protein_id="NP_001161767.1" /db_xref="CCDS:CCDS26149.1" /db_xref="GeneID:238393" /db_xref="MGI:MGI:2182838" /translation="
MAGVSPAVFGCPDVTLGRNTAVREVQENITSVDSLTLASSNTDFAFSLYKELVLKNPDENVVFSPFSICTALALLSLGAKSNTLKEILEGLKFNLTETPEPDIHQGFRYLLDLLSQPGNQVQISTGSALFIEKHLQILAEFKEKARALYQAEAFTADFQQPLEATKLINDYVSNHTQGKIKELISDLDKRTLMVLVNYIYFKGKWEMPFDPDDTCKSEFYLDENRSVKVPMMKINNLTTPYFRDEELSCTVVELKYTGNASAMFILPDQGKMQQVEASLQPETLRNWKDSLKPRLINELCLPKFSISTDYSLEHILPELGIRELFSTQADLSAITGTKDLRTSQVVHKAVLDVAETGTEAAAGTGYQNLQCCQGVIYSMKIYFDRPFLMIISDTNTHIALFMAKVSNPESDENFLNVEYAFPQVLEIMPEYRSVCTCCLPCLTRQ"
misc_feature 168..1316 /gene="Serpina3f" /gene_synonym="2A1" /note="serpin family A member 3, alpha 1-antichymotrypsin; Region: serpinA3_A1AC; cd19551" /db_xref="CDD:381019" misc_feature 171..173 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 369..371 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 609..611 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000269|PubMed:16944957; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 864..866 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature order(1152..1190,1194..1205,1209..1211,1221..1247) /gene="Serpina3f" /gene_synonym="2A1" /note="reactive center loop (RCL); other site" /db_xref="CDD:381019" misc_feature 1158..1235 /gene="Serpina3f" /gene_synonym="2A1" /note="propagated from UniProtKB/Swiss-Prot (Q80X76.3); Region: RCL" misc_feature 1200..1205 /gene="Serpina3f" /gene_synonym="2A1" /note="Reactive bond. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (Q80X76.3); other site" exon 697..970 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 971..1121 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 1122..2042 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" ORIGIN
agcagaccaggaaggcagcagccctgcccaccaggagccagctaccacagacactggcctttgctccagctctgcaggagaagagagtaatggctggtgtctcccctgctgtctttggctgcccagatgtcaccctgggaaggaacactgcagtccgtgaagtccaagaaaatatcacatcagtggacagtttaacactggcctccagcaacactgactttgccttcagcctctacaaggagctggttttgaagaatccagatgaaaatgttgtcttctccccattcagcatctgcactgccttggccctgctgtccctgggagcaaagagcaacaccctgaaggaaatcctagaaggtctcaagttcaacctcacagagacccctgaaccagacatccaccagggctttaggtacttgctagaccttctcagtcagccagggaaccaggtacagatcagcacaggcagtgccctgtttattgaaaagcacctgcagatcctggcagagttcaaggagaaagcaagggctctgtaccaggctgaggccttcacagcagatttccagcagcctctcgaggccacaaagctcatcaatgactatgtgagcaatcacacccaggggaagatcaaggaactcatttcagacctggataaaaggacattgatggtgctggtgaattacatctactttaaaggcaaatgggagatgccctttgatccggatgatacatgtaagtctgagttctacttggatgagaataggtctgtgaaggtgcccatgatgaaaattaataacctgacgacaccctacttccgggatgaggagctgtcctgcactgtggtggagctgaagtacacaggaaatgccagtgccatgttcatcctcccggaccagggcaagatgcagcaggtggaagccagcttgcaaccagagaccctgaggaattggaaggactctctgaagcccaggttgataaatgagctctgcctgcccaagttctccatctccaccgactacagcctggagcacatccttcctgagctgggcatcagggagctcttctccacccaggctgacctgtctgcaatcacaggaaccaaggatctgagaacttctcaggtggtccacaaggctgtgctggatgtggctgagacaggcacagaagcagctgctggcacaggatatcaaaatctccaatgttgtcaaggtgtaatctactctatgaaaatatatttcgacaggccattcctgatgattatctctgacacaaacactcatattgccctctttatggcaaaagtttcaaatccagagagtgatgagaacttcctaaatgtggagtatgcttttccccaagtgctggaaattatgcctgaatataggtctgtctgcacatgttgccttccatgtctgactagacagtgacactgaccaattctgtcacgtcctcatgcagagaaacaagcctatgactggttattgtcagactccctgtcataatggtagcactaaatcaagttcctgacctgaaatttttgttattccccgtccctgctgtctccactgtatctgcttcaactcaaaagactgggaccgtcagtgaggctctctcctaacttaggctctgcttatgtctgccttcagcttttcagtaatgatgggactatacaagtttacaggccaacccataaggtttaagaagggaacctgcaactgtggtcctatctgcagcatctgaaatgtttggtgcccagttctaccttactcttgccttcctctgggcagagctattctcagtccctgcatagtctcctggccccacccagatctgatacaggtggagccctcacccctgcagctgcatggggctgtgggtcagggtagttcttctacccctagcactcctaatcaggacagagaagtcgcctaaccctaagtgtctagttgaccaaccacacaagacagatggacacctccaccttcatcacacaaattgaaagggcaggagctaaggatcaataaacatgtaactgcattgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]