GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:19:16, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Mus musculus PRAME like 25 (Pramel25), transcript variant 2, mRNA. (1410 bp)
ctgccctaagccaatgttctcacctcagagaggtcactttctatgataataatttctctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatcagtgagtgttaccctgcccctctggagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagctcctggatatactcaaagccaaaagacagctccaaagtgtctcctttgaaacaacccaatgctctaaatgtggtgggtgctacatttatgaccaggagacccaatgttgtcattttgtggaactactattagcttgattgcgaaaccgagaaatggaaacttagtattggggactgatgaaatcctaagtaaacgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacataggaaagtcaataccttcctcagagctggtgaatggatgttgcatctgcagaaagtatcaagcacttgtagtttgtgtgtgttacaatagaggcaccattttatgaaactggcccaatctgttttctgtgtacaataaatgtgttgactttct...
position 1077 1079 1080 1104 1106 1109 1110 1112 1117 1119 1120
Synonym: BC084594; Gm13023; MGC:91194
NM_001347246.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus PRAME like 25 (Pramel25), transcript variant 1, mRNA. (1838 bp)
ctgccctaagccaatgttctcacctcagagaggtcactttctatgataataatttctctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatcagtgagtgttaccctgcccctctggagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagctcctggatatactcaaagccaaaagacagctccaaagtgtctcctttgaaacaacccaatgctctaaatgtggtgggtgctacatttatgaccaggagacccaatgttgtcattttgtggaactactattagcttgattgcgaaaccgagaaatggaaacttagtattggggactgatgaaatcctaagtaaacgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacataggaaagtcaataccttcctcagagctggtgaatggatgttgcatctgcagaaagtatcaagcacttgtagtttgtgtgtgttacaatagaggcaccattttatgaaactggcccaatctgttttctgtgtacaataaatgtgttgactttct...
position 1505 1507 1508 1532 1534 1537 1538 1540 1545 1547 1548
Synonym: BC084594; Gm13023; MGC:91194
NM_001007077.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/mm/1455813_at
lang : en | div : | spe : mm | query_string : 1455813_at | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATTTTGTGGAACTACTATTAGCT)?source=Mus musculus (house mouse)?to=0&format=json
0.097 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGTCATTTTGTGGAACTACTATT)?source=Mus musculus (house mouse)?to=0&format=json
0.107 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGGAACTACTATTAGCTTGATTGC)?source=Mus musculus (house mouse)?to=0&format=json
0.115 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCTACATTTATGACCAGGAGACC)?source=Mus musculus (house mouse)?to=0&format=json
0.125 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCATTTTGTGGAACTACTATTAGC)?source=Mus musculus (house mouse)?to=0&format=json
0.135 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACTACTATTAGCTTGATTGCGA)?source=Mus musculus (house mouse)?to=0&format=json
0.143 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTACATTTATGACCAGGAGACCCA)?source=Mus musculus (house mouse)?to=0&format=json
0.154 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACTACTATTAGCTTGATTGCGAA)?source=Mus musculus (house mouse)?to=0&format=json
0.166 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTACATTTATGACCAGGAGACCCAA)?source=Mus musculus (house mouse)?to=0&format=json
0.177 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTTGTGGAACTACTATTAGCTTG)?source=Mus musculus (house mouse)?to=0&format=json
0.190 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGTTGTCATTTTGTGGAACTACTA)?source=Mus musculus (house mouse)?to=0&format=json
0.207 | 0.017 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATTTTGTGGAACTACTATTAGCT)%26(nt:GTTGTCATTTTGTGGAACTACTATT)%26(nt:GTGGAACTACTATTAGCTTGATTGC)%26(nt:GTGCTACATTTATGACCAGGAGACC)%26(nt:GTCATTTTGTGGAACTACTATTAGC)%26(nt:GGAACTACTATTAGCTTGATTGCGA)%26(nt:GCTACATTTATGACCAGGAGACCCA)%26(nt:GAACTACTATTAGCTTGATTGCGAA)%26(nt:CTACATTTATGACCAGGAGACCCAA)%26(nt:ATTTTGTGGAACTACTATTAGCTTG)%26(nt:ATGTTGTCATTTTGTGGAACTACTA)?source=Mus musculus (house mouse)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.208 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]