GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-06-15 18:44:36, GGRNA : RefSeq release 206 (May, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant X1, mRNA. (3779 bp)
tgtaatatgtggagaataaaagccaaagtcatacagaaatgcagtctaggtgacattcagagatgctgtgttgggctggtaccagaatgcattgatgtgtgtgctttaccgttgtgacttctcaatattctgcagcgtttcttaagagcatggttgtaatgttcgtaaagcagacctcatcataagaagaaaatgaatgacattttctctcctgtggaagtcccaatagccagagctcctgatattttagaaacagatggtttttaagtggccacatgtaattttatgcagttgactatatatcttaaacttaataagctcattttgtggttcattagtttaaggtatttgtttactaacatgtttttagagaaaatactgttacttggcattaattgtccatttacagtgttctgttaagttcctcatgctatgcaccttacataatttccctaaagaacagtcatctatcactgtggtgttaaaccgcaatctggatataacaaacaccatcactgcttgtgggtaatgtgctgtcatcatataaatattctaccttttcatgtatatagattgcatttcttaggtgttttaattttt...
position 3121 3148 3172 3208 3242 3261 3441 3456 3470 3550 3563
Synonym: 1700029A20Rik; 2010306G19Rik; 5730460G06Rik
XM_036163237.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant 4, mRNA. (4619 bp)
tgtaatatgtggagaataaaagccaaagtcatacagaaatgcagtctaggtgacattcagagatgctgtgttgggctggtaccagaatgcattgatgtgtgtgctttaccgttgtgacttctcaatattctgcagcgtttcttaagagcatggttgtaatgttcgtaaagcagacctcatcataagaagaaaatgaatgacattttctctcctgtggaagtcccaatagccagagctcctgatattttagaaacagatggtttttaagtggccacatgtaattttatgcagttgactatatatcttaaacttaataagctcattttgtggttcattagtttaaggtatttgtttactaacatgtttttagagaaaatactgttacttggcattaattgtccatttacagtgttctgttaagttcctcatgctatgcaccttacataatttccctaaagaacagtcatctatcactgtggtgttaaaccgcaatctggatataacaaacaccatcactgcttgtgggtaatgtgctgtcatcatataaatattctaccttttcatgtatatagattgcatttcttaggtgttttaattttt...
position 1559 1586 1610 1646 1680 1699 1879 1894 1908 1988 2001
Synonym: 1700029A20Rik; 2010306G19Rik; 5730460G06Rik
NM_001356364.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant 2, mRNA. (4839 bp)
tgtaatatgtggagaataaaagccaaagtcatacagaaatgcagtctaggtgacattcagagatgctgtgttgggctggtaccagaatgcattgatgtgtgtgctttaccgttgtgacttctcaatattctgcagcgtttcttaagagcatggttgtaatgttcgtaaagcagacctcatcataagaagaaaatgaatgacattttctctcctgtggaagtcccaatagccagagctcctgatattttagaaacagatggtttttaagtggccacatgtaattttatgcagttgactatatatcttaaacttaataagctcattttgtggttcattagtttaaggtatttgtttactaacatgtttttagagaaaatactgttacttggcattaattgtccatttacagtgttctgttaagttcctcatgctatgcaccttacataatttccctaaagaacagtcatctatcactgtggtgttaaaccgcaatctggatataacaaacaccatcactgcttgtgggtaatgtgctgtcatcatataaatattctaccttttcatgtatatagattgcatttcttaggtgttttaattttt...
position 1779 1806 1830 1866 1900 1919 2099 2114 2128 2208 2221
Synonym: 1700029A20Rik; 2010306G19Rik; 5730460G06Rik
NM_025926.5 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant 1, mRNA. (4861 bp)
tgtaatatgtggagaataaaagccaaagtcatacagaaatgcagtctaggtgacattcagagatgctgtgttgggctggtaccagaatgcattgatgtgtgtgctttaccgttgtgacttctcaatattctgcagcgtttcttaagagcatggttgtaatgttcgtaaagcagacctcatcataagaagaaaatgaatgacattttctctcctgtggaagtcccaatagccagagctcctgatattttagaaacagatggtttttaagtggccacatgtaattttatgcagttgactatatatcttaaacttaataagctcattttgtggttcattagtttaaggtatttgtttactaacatgtttttagagaaaatactgttacttggcattaattgtccatttacagtgttctgttaagttcctcatgctatgcaccttacataatttccctaaagaacagtcatctatcactgtggtgttaaaccgcaatctggatataacaaacaccatcactgcttgtgggtaatgtgctgtcatcatataaatattctaccttttcatgtatatagattgcatttcttaggtgttttaattttt...
position 1801 1828 1852 1888 1922 1941 2121 2136 2150 2230 2243
Synonym: 1700029A20Rik; 2010306G19Rik; 5730460G06Rik
NM_027287.5 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus DnaJ heat shock protein family (Hsp40) member B4 (Dnajb4), transcript variant 3, mRNA. (4907 bp)
tgtaatatgtggagaataaaagccaaagtcatacagaaatgcagtctaggtgacattcagagatgctgtgttgggctggtaccagaatgcattgatgtgtgtgctttaccgttgtgacttctcaatattctgcagcgtttcttaagagcatggttgtaatgttcgtaaagcagacctcatcataagaagaaaatgaatgacattttctctcctgtggaagtcccaatagccagagctcctgatattttagaaacagatggtttttaagtggccacatgtaattttatgcagttgactatatatcttaaacttaataagctcattttgtggttcattagtttaaggtatttgtttactaacatgtttttagagaaaatactgttacttggcattaattgtccatttacagtgttctgttaagttcctcatgctatgcaccttacataatttccctaaagaacagtcatctatcactgtggtgttaaaccgcaatctggatataacaaacaccatcactgcttgtgggtaatgtgctgtcatcatataaatattctaccttttcatgtatatagattgcatttcttaggtgttttaattttt...
position 1847 1874 1898 1934 1968 1987 2167 2182 2196 2276 2289
Synonym: 1700029A20Rik; 2010306G19Rik; 5730460G06Rik
NM_001356363.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/mm/1451177_at
lang : en | div : | spe : mm | query_string : 1451177_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCCTCATGCTATGCACCTTACATAA)?source=Mus musculus (house mouse)?to=0&format=json
0.104 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTTCGTAAAGCAGACCTCATCATAA)?source=Mus musculus (house mouse)?to=0&format=json
0.114 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGTTCTGTTAAGTTCCTCATGCTA)?source=Mus musculus (house mouse)?to=0&format=json
0.126 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGGAAGTCCCAATAGCCAGAGCTC)?source=Mus musculus (house mouse)?to=0&format=json
0.135 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGCTTTACCGTTGTGACTTCTCAA)?source=Mus musculus (house mouse)?to=0&format=json
0.144 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGCTGGTACCAGAATGCATTGATGT)?source=Mus musculus (house mouse)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAATGACATTTTCTCTCCTGTGGAA)?source=Mus musculus (house mouse)?to=0&format=json
0.164 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTGCTTGTGGGTAATGTGCTGTCAT)?source=Mus musculus (house mouse)?to=0&format=json
0.175 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATATTCTGCAGCGTTTCTTAAGAGC)?source=Mus musculus (house mouse)?to=0&format=json
0.183 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACAAACACCATCACTGCTTGTGGGT)?source=Mus musculus (house mouse)?to=0&format=json
0.192 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AATTGTCCATTTACAGTGTTCTGTT)?source=Mus musculus (house mouse)?to=0&format=json
0.240 | 0.048 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCCTCATGCTATGCACCTTACATAA)%26(nt:GTTCGTAAAGCAGACCTCATCATAA)%26(nt:GTGTTCTGTTAAGTTCCTCATGCTA)%26(nt:GTGGAAGTCCCAATAGCCAGAGCTC)%26(nt:GTGCTTTACCGTTGTGACTTCTCAA)%26(nt:GGCTGGTACCAGAATGCATTGATGT)%26(nt:GAATGACATTTTCTCTCCTGTGGAA)%26(nt:CTGCTTGTGGGTAATGTGCTGTCAT)%26(nt:ATATTCTGCAGCGTTTCTTAAGAGC)%26(nt:ACAAACACCATCACTGCTTGTGGGT)%26(nt:AATTGTCCATTTACAGTGTTCTGTT)?source=Mus musculus (house mouse)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.244 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]