GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:46:24, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Mus musculus predicted gene 2042 (Gm2042), transcript variant 2, mRNA. (1413 bp)
caatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctatagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagaatggcccaatctgttgactgcatacaataaatatgttgacttttttttttt
position 1082 1084 1086 1089 1090 1092 1095 1097 1099 1100 1132
Synonym: 100039087
NM_001270793.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus oogenesin 1 (Oog1), mRNA. (1840 bp)
caatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctctagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagactggcccaatctgttgactgcatacaataaatctgttgactttttaaaaa
position 1510 1512 1514 1517 1518 1520 1523 1525 1527 1528 1560
Synonym: c-1; O; Oog
NM_178657.5 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus predicted gene 2042 (Gm2042), transcript variant 1, mRNA. (1841 bp)
caatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctatagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagaatggcccaatctgttgactgcatacaataaatatgttgacttttttttttt
position 1510 1512 1514 1517 1518 1520 1523 1525 1527 1528 1560
Synonym: 100039087
NM_001270792.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Mus musculus oogenesin 1 (Oog1), transcript variant X1, mRNA. (1978 bp)
caatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctctagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagactggcccaatctgttgactgcatacaataaatctgttgactttt
position 1654 1656 1658 1661 1662 1664 1667 1669 1671 1672 1704
Synonym: c-1; O; Oog
XM_006515619.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Mus musculus predicted gene 2042 (Gm2042), transcript variant X1, mRNA. (1979 bp)
caatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctatagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagaatggcccaatctgttgactgcatacaataaatatgttgacttttt
position 1654 1656 1658 1661 1662 1664 1667 1669 1671 1672 1704
Synonym: 100039087
XM_006515315.3 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/mm/1427976_at
lang : en | div : | spe : mm | query_string : 1427976_at | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTATGATCGGCATACCCAATGTTG)?source=Mus musculus (house mouse)?to=0&format=json
0.097 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGGCATACCCAATGTTGCCGTTTT)?source=Mus musculus (house mouse)?to=0&format=json
0.105 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATGATCGGCATACCCAATGTTGCC)?source=Mus musculus (house mouse)?to=0&format=json
0.112 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATAAGCTTGATTGTGAAACTGAGA)?source=Mus musculus (house mouse)?to=0&format=json
0.119 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACATTTATGATCGGCATACCCAAT)?source=Mus musculus (house mouse)?to=0&format=json
0.126 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCTACATTTATGATCGGCATACC)?source=Mus musculus (house mouse)?to=0&format=json
0.133 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCATACCCAATGTTGCCGTTTTGT)?source=Mus musculus (house mouse)?to=0&format=json
0.139 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTACATTTATGATCGGCATACCCA)?source=Mus musculus (house mouse)?to=0&format=json
0.146 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCATACCCAATGTTGCCGTTTTGTG)?source=Mus musculus (house mouse)?to=0&format=json
0.154 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCGGCATACCCAATGTTGCCGTT)?source=Mus musculus (house mouse)?to=0&format=json
0.167 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTATGATCGGCATACCCAATGTT)?source=Mus musculus (house mouse)?to=0&format=json
0.214 | 0.048 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTATGATCGGCATACCCAATGTTG)%26(nt:TCGGCATACCCAATGTTGCCGTTTT)%26(nt:TATGATCGGCATACCCAATGTTGCC)%26(nt:TATAAGCTTGATTGTGAAACTGAGA)%26(nt:TACATTTATGATCGGCATACCCAAT)%26(nt:GTGCTACATTTATGATCGGCATACC)%26(nt:GGCATACCCAATGTTGCCGTTTTGT)%26(nt:GCTACATTTATGATCGGCATACCCA)%26(nt:GCATACCCAATGTTGCCGTTTTGTG)%26(nt:GATCGGCATACCCAATGTTGCCGTT)%26(nt:ATTTATGATCGGCATACCCAATGTT)?source=Mus musculus (house mouse)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.218 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]