GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 18:46:54, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_012137205             549 bp    RNA     linear   PLN 17-APR-2025
DEFINITION  PREDICTED: Elaeis guineensis uncharacterized protein
            (LOC105058002), misc_RNA.
ACCESSION   XR_012137205
VERSION     XR_012137205.1
DBLINK      BioProject: PRJNA268357
KEYWORDS    RefSeq.
SOURCE      Elaeis guineensis (African oil palm)
  ORGANISM  Elaeis guineensis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Arecaceae; Arecoideae;
            Cocoseae; Elaeidinae; Elaeis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_026007) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000442705.2-RS_2025_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/14/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..549
                     /organism="Elaeis guineensis"
                     /mol_type="transcribed RNA"
                     /isolate="ETL-2024a"
                     /db_xref="taxon:51953"
                     /chromosome="15"
                     /authority="Elaeis guineensis Jacq."
     gene            1..549
                     /gene="LOC105058002"
                     /note="uncharacterized LOC105058002; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:105058002"
     misc_RNA        1..549
                     /gene="LOC105058002"
                     /product="uncharacterized protein"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:105058002"
ORIGIN      
ctgtcaatctcttcttgaaatattcccttggataaatcgtggtgacaatgttcgatgtttgcaagttaaatgatgattcaaaacaaacaacttggtgaaagctctgataaagtaacaaagcattgattctttcatactgatggttttcctttatcctctaccaacagaaaggaagctatggttcttcaaattctgtatggcttatatttgggctttccaattcattgcctctttgcctttcaaatacatgcagtcactgtatcatgactgggacgtcaaattgaatggctatactagtgtcacgtgatcaacaatttcactgcttatgaagcttgattgatggcaactggctcccaggaccatggtgctgttcttggtcttgcttggctccacaaaagggatgttgaagcccagcttgctctatcagctgaactttgttgtaagtgcataaatgtggcttatcgactacttcgacaatttgattctcgagctggattcggattgtatcttttgcatgaaagaatgattgatcatcttttgtgacatcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]