LOCUS       XM_068303581            2355 bp    mRNA    linear   INV 13-SEP-2024
DEFINITION  PREDICTED: Drosophila tropicalis protein argonaute-2-like
            (LOC137587253), mRNA.
ACCESSION   XM_068303581
VERSION     XM_068303581.1
DBLINK      BioProject: PRJNA1159848
KEYWORDS    RefSeq.
SOURCE      Drosophila tropicalis
  ORGANISM  Drosophila tropicalis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Brachycera;
            Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; Sophophora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027172367) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_018151085.1-RS_2024_09
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/12/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2355
                     /organism="Drosophila tropicalis"
                     /mol_type="mRNA"
                     /isolate="14030-0801.00"
                     /db_xref="taxon:46794"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="whole fly"
                     /dev_stage="Adult fly"
                     /geo_loc_name="El Salvador"
                     /collection_date="1955"
     gene            1..2355
                     /gene="LOC137587253"
                     /note="protein argonaute-2-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 98
                     Proteins"
                     /db_xref="GeneID:137587253"
     CDS             1..2355
                     /gene="LOC137587253"
                     /codon_start=1
                     /product="protein argonaute-2-like"
                     /protein_id="XP_068159682.1"
                     /db_xref="GeneID:137587253"
                     /translation="

MPSKAYHYDVKIVPERPRKFYRDAFEQFRIIHLNNATAAFDGRASCYSVDKLNTATKCGDVKVTDAHGRNLNYNVQIKETASPQVDLNSLRSYMKDKMYDKPMQALQCLEVVLASPCHRKAIRVGRSFFKMAEPDRRMDLGDGYECLIGLFQSLVLGDRPFVNVDISHKSFPIALSVLEYIERYVLKESIKNTTNLDRLYPSTEQYLKDLTIVYEPPPSFDSVPRVFKVNGLTSSPARYQKFQFANKTVTVEEYYRSRNYPLRYPNLRCLYAGPLSKNIFLPLELCRIEDGQPLTRKDGTNQVASIIKFAATSTNERKAKINNLLKFIAHNHDPSISRFGIKIHNDFIVVHTRTLSPPLVEYRNKQMSMVRNGSWRMDQRAQFLEPKQKVHKWAILYSDGKRKLSYNQVADLGNMFRRQGLSLKVCLEEMPEIRSFRDERELDSCFDDLRRSKHDLVIVIIPQSGVSYDTIKQKAELKHGILTQCLRQFTVERKLNPQLIGNVLLKINAKLNGINHKLKDEPNRLLSNAMFLGADATHPSPDQREMPSVVGVAASHDLYGAAYNMQYRLQRSTVEEIEDMETIVTEHLRIYHSYRKRYPDHIIYYRDGVSVGQFPKIKALELRGINAACAKLRISPKLCCVIVVKRHHTRFFPPGAPSQGNKFNNVDPGTVVDSVIVHPNEVQFFMVSHQSIQGTAKPTRYNVIENTANLDIDLLQQLTFNLCHMFPRCTRSVSYPAPAYLAHLVAARGRVYLTGTTLFKSPKEEYKKRLISPSLTAANPMYFV"

     misc_feature    121..339
                     /gene="LOC137587253"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    370..513
                     /gene="LOC137587253"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    520..864
                     /gene="LOC137587253"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(679..681,724..726,751..753,763..765,814..816,
                     835..837,841..843)
                     /gene="LOC137587253"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1000..2259
                     /gene="LOC137587253"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1402..1404,1414..1416,1450..1461,1468..1470,
                     1495..1497,1504..1506,1516..1518,1528..1530)
                     /gene="LOC137587253"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1603..1605,1609..1611,1819..1821,2227..2229)
                     /gene="LOC137587253"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

atgccgtcaaaggcatatcattatgatgtgaagatcgtgccggagcggccaaggaagttttatcgcgatgcctttgaacagtttcgtataatccatctaaacaatgctacagctgctttcgatggccgagcctcgtgttactctgtagacaaactaaatactgctactaagtgtggtgatgtcaaggtgaccgatgctcatggacgaaatttaaactacaatgttcagattaaagagactgcgagtccccaagtcgacctgaactctcttcgcagctatatgaaagacaaaatgtacgacaagcccatgcaagccttgcagtgtctggaggtagtcttggcatcaccttgccacaggaaagcgattcgcgtggggcgctccttttttaaaatggctgagcccgataggcgcatggatctcggcgatggttacgagtgcctgattggtctttttcagtccttggttttaggagatcgaccattcgtgaatgtagacatctcgcacaaatcctttcccatcgctctttctgttttggagtatatagaacgttacgtcttgaaagaatcgattaaaaatacaaccaacctggacagattgtatccatcaacggagcagtacttgaaagatttaaccatagtttatgagccaccgccaagtttcgacagtgtaccacgcgtgtttaaagtgaacgggctaacatcatcgccggccagataccaaaaattccagtttgctaacaaaaccgtgacggtagaagaatactaccgaagtcgtaactatcccttaaggtacccgaatctgcgttgtttgtatgccggacccttgtctaagaatatctttctgccactcgaactgtgccgcatcgaagacggccagccattgactcgcaaagacggcactaatcaggtcgcgtctataatcaaatttgctgccacttcgaccaacgaacgcaaagcaaagatcaacaacttactcaagtttatagcacacaatcatgatccttccataagtcgcttcggtattaaaattcacaacgattttattgtagtccatacacgtactctcagcccgccgttggtggaatacaggaataagcaaatgtcgatggttaggaatggctcttggcgcatggaccaacgcgcccagttcttggaaccgaaacagaaggtccataaatgggccattctttattcagatggcaaacgcaaattgtcatataatcaggttgctgaccttggaaacatgttccggcgccagggactttcgctaaaagtctgcctggaggaaatgcccgaaataaggtcttttagagatgaaagggagttggatagttgttttgatgacctaaggcgcagtaagcacgatttggtgattgtgatcataccccaatctggagtgtcctatgacaccatcaagcagaaagctgagcttaaacatggtatactgacacagtgcctcaggcaattcacagtcgagcgtaaattaaatccgcaactgattggcaatgttcttctgaagatcaatgcgaaactgaatggcataaatcacaagttaaaagatgaaccaaatcgactgctatcaaatgcaatgtttctgggagccgatgctacccatccttcgccggatcaaagggaaatgcctagtgttgttggtgtcgctgcctcacatgatctctatggagctgcctataacatgcaataccgtctacagcgttcaactgtcgaagagatcgaggatatggaaacaattgtcacggaacatttacgaatttatcattcatatcgcaaacgatatccggaccatattatctattatcgcgatggagtaagtgtgggccaatttccaaaaattaaagctctcgaactgaggggcattaatgcggcatgcgccaagctgcgtataagccccaaactatgttgtgtaatagtggtaaaacgccatcacacacgattctttcctcccggtgctccttcgcagggcaataaattcaacaatgtggatccaggaacagttgtagatagcgtcattgtccacccaaatgaggtgcaattctttatggtcagccatcaatccattcaaggcacagccaagccaacccgttacaacgttatcgagaacactgccaacttggacattgatttgttgcagcaattaacctttaacctgtgtcacatgtttcctcgctgcactcgctcggtctcgtatccagctccagcatatttggctcacttggtagccgcacgtggacgtgtctatcttactggaactacattgttcaaatcacccaaggaagaatacaagaagcgtttaatctctccctccttgactgctgcgaatcctatgtattttgtttaa

//