2025-04-20 18:55:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_064566651 1745 bp mRNA linear VRT 25-APR-2024 DEFINITION PREDICTED: Latimeria chalumnae vimentin-related 2 (VIMR2), mRNA. ACCESSION XM_064566651 VERSION XM_064566651.1 DBLINK BioProject: PRJNA1100969 KEYWORDS RefSeq; includes ab initio. SOURCE Latimeria chalumnae (coelacanth) ORGANISM Latimeria chalumnae Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Coelacanthiformes; Coelacanthidae; Latimeria. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_088153) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_037176945.1-RS_2024_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/18/2024 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 1% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1745 /organism="Latimeria chalumnae" /mol_type="mRNA" /isolate="fLatCha1" /db_xref="taxon:7897" /chromosome="15" /sex="female" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="Comoros: Grande Comore Island, Africa" /lat_lon="11.583333 S 43.333333 E" /collection_date="2003" /collected_by="Ahamada Said" gene 1..1745 /gene="VIMR2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:102349890" CDS 1..1107 /gene="VIMR2" /codon_start=1 /product="low molecular weight neuronal intermediate filament" /protein_id="XP_064422721.1" /db_xref="GeneID:102349890" /translation="
MCSARVSSYRRIFHEDLGSLHPVVSYDWGGRHRVAARSDCIVDEVEDDEISFRTALSRDYLVRCLKNRGLMARLNNRLVNFIENVRCLEEENEVLEAEIELMRESVQRYCHLSSQQRQDLWELSAVVEKLEREKEETWAEIGALHQELCARKLKHEQLSELRSLVEEETDKLIPEIDLLTGECLGLKKEAEILEDQLDHMQQEHEMQVGELLSPEEEESVVLSLDFTSPDMVPAVLDIQEHYQDLASCLKLSGRVSRAIQGGTEDAEDTKENLKLMITDLEKELAYLIMRNEQLETEIQENEMANEDEIICLEDELAELKQWISTLKSEMAEKVKDYRQLLSAKMALDLEIAAYRSFIEEEDERLYHP"
polyA_site 1745 /gene="VIMR2" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
atgtgcagcgcccgagtttcatcctaccggcggatcttccacgaggacctgggttctcttcaccctgtggtcagttacgactggggtggacggcatcgtgttgcagccaggtcagactgtatcgttgatgaagtcgaagatgatgaaataagtttccgaactgctttgagtcgagactatctggtgagatgtctgaagaaccggggtctgatggcaagactcaataatcggctggtgaactttatagaaaatgttcgttgcttggaagaagagaatgaagttctggaagctgaaattgagttaatgcgggagagcgtgcagagatactgccacctgtcatcacagcaaagacaggacctctgggagctcagtgcagtggtggagaagctggaaagggagaaggaggagacctgggcagagattggtgccctgcatcaggaactgtgcgctcgcaagctgaaacacgagcagctctccgaactgcggagtctagtggaggaggaaacggacaaactcataccagagattgatcttctcacaggagagtgtctgggcctcaagaaggaggctgagatcctggaggaccagttggatcacatgcagcaggaacatgagatgcaagttggagagctgctgtctcctgaagaagaggagtctgttgttttgagtttggatttcacgtctcctgacatggttcctgcagtcctagacattcaggaacactaccaggatctggctagctgtctgaagctgtctggaagagtctctagagccatacagggaggaacagaagacgctgaagatacaaaagagaacctcaagctaatgattactgacttggaaaaggagctggcgtacctaataatgagaaatgaacagctggagactgaaatccaggagaacgaaatggccaatgaagacgagatcatctgcctagaggatgaacttgctgagctgaagcaatggataagcactctgaaaagtgagatggcagaaaaggtgaaggactataggcaacttctgagtgccaaaatggcgctggacttggaaatagcagcttacaggagctttattgaagaagaggatgaaaggctataccatccttaaactggcaaacttctgctctttaaaaccaaaaaaaaagaaaaagaagagatttctggtaggaatgctgtgtaaaagaaacatgcatgtctatgaggaatatgccactatttgatgtgctttgctctgatgttccgccatgtacattattacctctatttcaaagaaaaaacttattactgcatccttcacctgtgtcagtcaatcattggcagtgaaagaaggagcgataatttgtgtttcctctgaaaatgctaactatagctcgagtgaaaccatcaggattgtcacatcaaatgctgttgtagtccccaaagacagttgtgctttcaaatactgaaaagacaacttgactatatttttggcaagacatttatggcactgctgggtttttctactcttgcagctgaagcataggaatgacttttccagtttaccccctcctcttctaaaccttaacagcagtgtgttcttctggacttttgaatattctatgtttgtcagcaataacgaaccctaagattaatctttcattcaggaatctgtgtcactgcattagtactggtgctttatacttacaatggaacaattcaaaaaagaaaacccagtgatactggtaataaatccatgcaataatgaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]