ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-18 22:54:09, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_036144920 2495 bp mRNA linear VRT 10-SEP-2020 DEFINITION PREDICTED: Fundulus heteroclitus testis and ovary specific PAZ domain containing 1 (topaz1), mRNA. ACCESSION XM_036144920 VERSION XM_036144920.1 DBLINK BioProject: PRJNA615222 KEYWORDS RefSeq. SOURCE Fundulus heteroclitus (mummichog) ORGANISM Fundulus heteroclitus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes; Fundulidae; Fundulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_046373.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Fundulus heteroclitus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2495 /organism="Fundulus heteroclitus" /mol_type="mRNA" /isolate="FHET01" /db_xref="taxon:8078" /chromosome="13" /sex="male" /tissue_type="pool" /dev_stage="adult" gene 1..2495 /gene="topaz1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:105931937" CDS 343..2055 /gene="topaz1" /codon_start=1 /product="protein TOPAZ1" /protein_id="XP_036000813.1" /db_xref="GeneID:105931937" /translation="
MCRFQHLPVEGDEKFCVDAVAKFSKHPACLLKAGAVFTGYYQNSPPGAYFSMPVLLTLLWALLKAGMVSHVFSVLHVSLAHKLVPDHEFLLALFNYVRDKGLQSLIPELMELTFKMAGVGLELDLDWMENVKNTPMFQQTAQQTSHDALVGNHNPELLNLLHGIVEIELCVKQEDWKRMGEVYKALCQFSQHPNQVERISGRVAVALLSESKDKVSLPFAAFAETACQGESGENLVKSFLGRIGVTLMLRYHKNQHWTKGCRVVEVMSVLKVDYTVLKSLFGNEHGVSRCYIISVAAELFFLSGSVEGALKTLREHNWFLSSSSWPCEPADLERRTNVLRRLAGKTSYRDTLEVLCNLPGVKEPNDLIDISRYSPLFASHLQVCVERQVLPVASDTLDFMLCKKLAVEHPLLQAVLDKLGKQNLWLRARELFKHSLNVGYYPGVSAAPGSMALIVPCQLGEVELAITLEMFVALNASAILPLSDTATGPPLSITLRRTLSCEVEYISAGNRLLSAACLPQPKLTVHYIEVNSSQEQVFRLHVPTAHRWLRHNHSWASEMWTQQAKCLNPN"
misc_feature 841..1365
/gene="topaz1"
/note="Putative aspartate racemase; Region:
Asp_Glu_race_2; pfam14669"
/db_xref="CDD:464250"
ORIGIN
cagccagtggcagcggctcttgaagacgacgaggagagcgaaagcaggccgtggagacctcggtgtggcggcgtctctaccagaggtccaaacccgtgtcccgtcgccgtcagccagagcagacacgtgggcccctccggcgaaaacagtaggatagatggcaaatgtaatcttggtcaacccatcaagaaagtgagcttctcccacagcgtccccccagtcacggccttacaaacgggacccgctgtgaaaaccccagcgactaggacagatcctaggtgccagaaatctaatgtttactgcagactgtacttcagtgaatcgctgtcctgtggctacaaaatgtgtcgcttccagcatctaccagtggagggggatgagaagttctgtgttgacgctgtggcaaagttctccaaacatccagcttgcctcctgaaagcaggagctgtgtttacagggtactaccagaacagcccaccgggggcgtacttctccatgccggtgctcctgaccctcctttgggctctgcttaaagctggcatggtgtcccatgtcttctcagtccttcacgtcagcttggcccataaattagtgcctgaccacgagttcctgctggctctttttaactatgtgagagacaaggggctccagagcttgataccagaactgatggagctcaccttcaagatggccggcgttggtttggagctggacttggactggatggaaaatgtgaaaaacactcccatgtttcagcagacggctcagcagacgtcacacgatgctttggttggcaaccacaatcctgagctgctgaatttattgcatgggattgttgaaatagagctttgtgtcaagcaagaagactggaaacggatgggagaggtgtataaggccctctgccagttcagccagcaccctaaccaagtggagcgcatcagcggccgcgtcgccgtagcccttctgtctgagagcaaagacaaggtgtcactgccctttgctgcttttgctgagacagcgtgtcagggtgaaagtggggagaaccttgttaagagttttttgggcagaatcggagtcactttgatgttaagataccacaaaaaccagcattggactaagggctgcagagtggtggaggtgatgtctgttttaaaagtggactacaccgtactgaagagtttatttggaaatgaacatggagtatcacgctgctacattatcagtgtggcagcagagctcttcttcctgagtggaagtgtggaaggagctctgaagacacttcgagaacacaactggttcctgagttcgagttcgtggccatgtgagcctgctgatctggagaggaggactaatgtgttgaggcgtctggctggtaaaacctcctaccgggacacgctggaggtgctctgcaatctgccaggagttaaggaacccaacgacttgatagacatctccaggtacagtcctctgtttgcgtctcacctccaagtgtgcgtggagaggcaggttctacctgtggcgtcggacacgctggacttcatgctgtgtaaaaagctggctgttgagcacccactgctccaggcggtgctcgacaaactggggaaacagaacctgtggctgcgggcgcgggaactcttcaaacattcgttgaatgtgggctactaccctggagtgtctgcagcccccggttcgatggcgctgattgtaccatgtcagcttggagaggtggagcttgccatcaccttggagatgttcgttgccttaaatgcgtcggccattcttcctctttcagacaccgccaccggtcctcctctcagcatcactctaagaaggactctcagctgtgaggtggagtacatctcagcaggtaaccgccttctttccgcagcttgccttcctcagcccaaactcactgtccactacatcgaggtcaactcctcccaggagcaggtgtttaggctccacgttcccaccgcacaccgctggctccgccacaaccactcatgggccagcgagatgtggacacagcaagctaaatgtttaaaccctaactgatcttggcaagtatttgacattgtttatgttcagcatcagtgagttctccaggaaaggtcaatgaatcaggtagaaccacgtgtttcatctcaagttctatgggggcgggggggctaacggcagaaaattgcaaccttttttggctttcactcagttttaagggactatttgaatttatttattttgggaaacagtttatttttttgggggttggggggtgtaaggctgtttacctgtatataaaatttgaatgtaaatatgtatttatatgaccacattatgtttctgtattgtttgttacaatataaagtgttgcttgttcagagcttgcaatttaccatttctttgtatgaaatgttttattaaaagcttgcttctctgtgtgcgtgtacatatttatagacaacattctttacatgcaatattgaggaaaagtggat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]