ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-18 22:54:08, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_010138084 1034 bp mRNA linear VRT 06-NOV-2014 DEFINITION PREDICTED: Buceros rhinoceros silvestris testis- and ovary-specific PAZ domain-containing protein 1-like (LOC104495146), partial mRNA. ACCESSION XM_010138084 VERSION XM_010138084.1 DBLINK BioProject: PRJNA266010 KEYWORDS RefSeq; includes ab initio. SOURCE Buceros rhinoceros silvestris ORGANISM Buceros rhinoceros silvestris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Coraciimorphae; Bucerotiformes; Bucerotidae; Buceros. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_010390492.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Buceros rhinoceros silvestris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 6% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..1034 /organism="Buceros rhinoceros silvestris" /mol_type="mRNA" /isolate="BGI_N320" /sub_species="silvestris" /db_xref="taxon:175836" /chromosome="Unknown" /sex="male" gene <1..1034 /gene="LOC104495146" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:104495146" CDS <1..1034 /gene="LOC104495146" /codon_start=3 /product="testis- and ovary-specific PAZ domain-containing protein 1-like" /protein_id="XP_010136386.1" /db_xref="GeneID:104495146" /translation="
IKNSQHNEADRIFIGRIGISVIYSYHKVLQWIKGRKVLDKLYELQIHFTVLKGLTDAGRFASRCQIVNKAAEFFIQTGSLDGATWVLRESEWTTNAPLWPCNKTDILDRHNLLCTLVHKYLRRNLYRQALEVLQNLPGFQNDSDTTDVSQYSCLFNKLINACFESKNLGISSSAVDFMLSKNIAIDFSVLRGLITALGRNSLWSKARTYYKSALSLGCYLPLQGNFYHERLMMPSYLSEVEMLLAIEVFLVSNANYIQSPMAISHTLQIILKRCEDQTVQNNGDYQASVERLTLAARISDPKLFLKHMTVNINREEVYSLELTSALKWLQENMKWAGKVWLFQ"
misc_feature <1..347
/gene="LOC104495146"
/note="Putative aspartate racemase; Region:
Asp_Glu_race_2; pfam14669"
/db_xref="CDD:464250"
misc_feature 345..413
/gene="LOC104495146"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
misc_feature 429..545
/gene="LOC104495146"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
misc_feature 561..635
/gene="LOC104495146"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
ORIGIN
taataaaaaattcacaacataatgaagcagacagaattttcattggaaggattgggataagtgtaatatattcttatcacaaagtactgcagtggataaagggaaggaaggttttagataaattgtatgagctacagatacattttacagtcctgaaaggacttacagatgcagggaggttcgcatcaagatgtcaaatagttaataaagctgcagaattttttattcagactggaagtttggatggagcgacatgggtgttgagagagtcagagtggaccacaaatgcaccattgtggccctgtaataaaacagacatccttgatcgccataatctgctatgtacactcgtgcacaagtacttgaggaggaatttatacaggcaggcacttgaagttctgcagaacttaccaggttttcaaaatgattctgatactacagatgtttctcagtacagctgcctttttaacaaactgataaatgcctgttttgagagcaagaaccttgggatctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgatttttctgtacttagaggattaatcactgctttgggaagaaattctttgtggtctaaagctaggacctattacaaaagtgctttatcattgggttgctacctaccactgcagggaaatttctatcacgaacgtttgatgatgccgtcgtacctgtctgaggttgagatgctgttggccattgaagtatttcttgtttcaaatgccaattatattcaaagtccaatggctattagtcacactcttcaaataatactgaaaagatgtgaagatcagacagttcagaacaacggtgactatcaagcatcagtggagagactgaccctggctgctcgtatatctgatccaaagctttttcttaagcatatgacagtgaatattaatagggaagaagtttacagcttggagcttacatctgctctaaaatggcttcaggagaatatgaaatgggctggcaaggtctggctgtttcagtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]