LOCUS       XM_010009996            1488 bp    mRNA    linear   VRT 31-OCT-2014
DEFINITION  PREDICTED: Nestor notabilis testis- and ovary-specific PAZ
            domain-containing protein 1-like (LOC104402189), partial mRNA.
ACCESSION   XM_010009996
VERSION     XM_010009996.1
DBLINK      BioProject: PRJNA264990
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Nestor notabilis (Kea)
  ORGANISM  Nestor notabilis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Psittaciformes; Psittacidae; Nestor.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_009918950.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nestor notabilis Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 5% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1488
                     /organism="Nestor notabilis"
                     /mol_type="mRNA"
                     /isolate="BGI_N333"
                     /db_xref="taxon:176057"
                     /chromosome="Unknown"
                     /sex="male"
     gene            <1..1488
                     /gene="LOC104402189"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:104402189"
     CDS             <1..1488
                     /gene="LOC104402189"
                     /codon_start=1
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1-like"
                     /protein_id="XP_010008298.1"
                     /db_xref="GeneID:104402189"
                     /translation="

PAVDVLLKVFEHVASLNIKDAVPTLISTFCKLIGAGMFLESTHFDCIIKYLHQLKVSSQELNTVLNIKSRFQEKHFEKNWVFDFNLAVAEIQHCKEKKDWAKLGALFVNARTGCEHFDDLQKLSLCIAEILTKDSETNRPEVPFCDFADAVAKNSQHNEADRIFIGRIGISVMYSYHKVLQWIKGRKVLDKLHELQIHFTVLKGLIGAEKLASRCQIVNKAAEIFLKTGSMDGATWVLRESEWTTNTPLWPCDKMDILSRHNLLCTLVHKYLRKSLYRQALEVLQNLPGFRNHSDTVDVSQYSSLFNKLINACFESKNLGVSSSAVDFMLSKNIAIDFFLLRELITALGRSSLWSKARTYYKSALSLGCYPPPLQGNLYHKLLMIPSYLSEVEMLLAIEIFLVSNASDIQSPMATSQTLQIILKRCADQTVQNSSDYQAAVERLILAARVSDPKLFLKHMTMNVNMEEVYSLELTSALKWLQENMKWAGKVWLFQ"

     misc_feature    271..798
                     /gene="LOC104402189"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
     misc_feature    796..870
                     /gene="LOC104402189"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    886..996
                     /gene="LOC104402189"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
     misc_feature    1012..1086
                     /gene="LOC104402189"
                     /note="PPR repeat [structural motif]; Region: PPR repeat"
                     /db_xref="CDD:276811"
ORIGIN      

ccagctgtagatgttcttctgaaagtttttgagcatgtggcttctctgaatataaaagacgctgtgccgacattaatcagtaccttttgtaagctcattggtgctggtatgttccttgagtctacacattttgactgtattattaagtaccttcaccaactgaaagtttccagtcaggaactaaatactgttttgaatataaaatcgagatttcaggaaaaacattttgaaaagaactgggtttttgacttcaacttggcagtggctgaaattcagcattgcaaagaaaaaaaagattgggccaagctgggagctttgtttgttaatgcaagaactggctgtgaacattttgatgatcttcagaaattgtctctatgtattgctgaaatactaaccaaagactctgagacaaacagaccagaagttcctttttgtgattttgctgatgcagtagcaaaaaattcacaacataacgaagcagacagaattttcattggaaggattgggataagtgtaatgtattcttatcacaaagtactgcagtggataaagggaaggaaggttttggataagttgcatgagctacagatacattttacagtcttgaaaggcctcataggtgcagagaagttagcatcaagatgccaaattgttaataaagctgcagaaatttttcttaaaacaggaagtatggatggagcaacatgggtattgagagagtcagagtggaccacaaatacaccgttgtggccctgtgataaaatggacatcctcagtcgacataatctgttatgtacactagtgcacaaatacttgaggaagagtttatacaggcaggcattggaagttctgcagaacttaccaggttttcgaaatcattctgatactgtagatgtttctcagtacagcagcctttttaacaagctgataaatgcctgttttgagagcaagaaccttggggtctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgatttttttttacttagagaattaatcacagctttgggaagaagttctttgtggtctaaagctaggacctattacaaaagtgctttatcattgggttgctacccaccaccactgcagggaaatttgtatcacaaactcctgatgattccatcttacctatcagaggttgagatgctgttggccattgaaatatttcttgtttcgaatgccagtgatattcaaagtccaatggctactagtcagactcttcaaataatactgaaaagatgtgcagatcagacagttcagaatagcagtgactaccaggcagcagtggagagactgatcctggctgctcgtgtatctgatccaaagctttttcttaagcatatgacaatgaatgttaatatggaagaagtttacagcttggagcttacatctgctctaaagtggcttcaggagaacatgaaatgggctgggaaggtctggctgtttcagtag

//