2025-04-20 18:55:43, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_019264 1541 bp mRNA linear ROD 29-JUL-2024 DEFINITION Rattus norvegicus protein kinase cAMP-dependent type II regulatory subunit alpha (Prkar2a), mRNA. ACCESSION NM_019264 VERSION NM_019264.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1541) AUTHORS Isensee,J., Kaufholz,M., Knape,M.J., Hasenauer,J., Hammerich,H., Gonczarowska-Jorge,H., Zahedi,R.P., Schwede,F., Herberg,F.W. and Hucho,T. TITLE PKA-RII subunit phosphorylation precedes activation by cAMP and regulates activity termination JOURNAL J Cell Biol 217 (6), 2167-2184 (2018) PUBMED 29615473 REMARK GeneRIF: RII phosphorylation precedes cAMP binding and controls the inactivation by modulating the reassociation involving the coordinated action of phosphodiesterases and phosphatases. REFERENCE 2 (bases 1 to 1541) AUTHORS Burgers,P.P., van der Heyden,M.A., Kok,B., Heck,A.J. and Scholten,A. TITLE A systematic evaluation of protein kinase A-A-kinase anchoring protein interaction motifs JOURNAL Biochemistry 54 (1), 11-21 (2015) PUBMED 25097019 REFERENCE 3 (bases 1 to 1541) AUTHORS Nishimura,T., Fujii,W., Sugiura,K. and Naito,K. TITLE Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by A-kinase anchor proteins (AKAPs) is required for meiotic arrest of porcine full-grown and growing oocytes JOURNAL Biol Reprod 90 (3), 58 (2014) PUBMED 24501172 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1541) AUTHORS Biesemann,C., Gronborg,M., Luquet,E., Wichert,S.P., Bernard,V., Bungers,S.R., Cooper,B., Varoqueaux,F., Li,L., Byrne,J.A., Urlaub,H., Jahn,O., Brose,N. and Herzog,E. TITLE Proteomic screening of glutamatergic mouse brain synaptosomes isolated by fluorescence activated sorting JOURNAL EMBO J 33 (2), 157-170 (2014) PUBMED 24413018 REFERENCE 5 (bases 1 to 1541) AUTHORS Nishimura,T., Sugiura,K. and Naito,K. TITLE A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein kinase (PKA) localization and is involved in meiotic maturation of porcine oocytes JOURNAL Biol Reprod 88 (4), 85 (2013) PUBMED 23426434 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1541) AUTHORS Kultgen,P.L., Byrd,S.K., Ostrowski,L.E. and Milgram,S.L. TITLE Characterization of an A-kinase anchoring protein in human ciliary axonemes JOURNAL Mol Biol Cell 13 (12), 4156-4166 (2002) PUBMED 12475942 REFERENCE 7 (bases 1 to 1541) AUTHORS Dwivedi,Y., Rizavi,H.S. and Pandey,G.N. TITLE Differential effects of haloperidol and clozapine on [(3)H]cAMP binding, protein kinase A (PKA) activity, and mRNA and protein expression of selective regulatory and catalytic subunit isoforms of PKA in rat brain JOURNAL J Pharmacol Exp Ther 301 (1), 197-209 (2002) PUBMED 11907174 REFERENCE 8 (bases 1 to 1541) AUTHORS Marx,S.O., Reiken,S., Hisamatsu,Y., Jayaraman,T., Burkhoff,D., Rosemblit,N. and Marks,A.R. TITLE PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts JOURNAL Cell 101 (4), 365-376 (2000) PUBMED 10830164 REFERENCE 9 (bases 1 to 1541) AUTHORS Feliciello,A., Cardone,L., Garbi,C., Ginsberg,M.D., Varrone,S., Rubin,C.S., Avvedimento,E.V. and Gottesman,M.E. TITLE Yotiao protein, a ligand for the NMDA receptor, binds and targets cAMP-dependent protein kinase II(1) JOURNAL FEBS Lett 464 (3), 174-178 (1999) PUBMED 10618500 REFERENCE 10 (bases 1 to 1541) AUTHORS Scott,J.D., Glaccum,M.B., Zoller,M.J., Uhler,M.D., Helfman,D.M., McKnight,G.S. and Krebs,E.G. TITLE The molecular cloning of a type II regulatory subunit of the cAMP-dependent protein kinase from rat skeletal muscle and mouse brain JOURNAL Proc Natl Acad Sci U S A 84 (15), 5192-5196 (1987) PUBMED 3037538 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF533978.1. On Aug 31, 2012 this sequence version replaced NM_019264.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF533978.1, J02934.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132261, SAMD00132262 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1541 AF533978.1 5-1545 FEATURES Location/Qualifiers source 1..1541 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="8" /map="8q32" gene 1..1541 /gene="Prkar2a" /note="protein kinase cAMP-dependent type II regulatory subunit alpha" /db_xref="GeneID:29699" /db_xref="RGD:3393" exon 1..365 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" misc_feature 44..46 /gene="Prkar2a" /note="upstream in-frame stop codon" CDS 110..1315 /gene="Prkar2a" /EC_number="2.7.11.1" /note="protein kinase, cAMP-dependent, regulatory subunit type II alpha; protein kinase, cAMP-dependent, regulatory, type 2, alpha; protein kinase cAMP-dependent type 2 regulatory subunit alpha; protein kinase, cAMP dependent regulatory, type II alpha" /codon_start=1 /product="cAMP-dependent protein kinase type II-alpha regulatory subunit" /protein_id="NP_062137.1" /db_xref="GeneID:29699" /db_xref="RGD:3393" /translation="
MSHIQIPPGLTELLQGYTVEVLRQQPPDLVDFAVEYFTRLREARRQESDSFIAPPTTFHAQESSGVPVIEEDGESESDSDDEDLEVPIPSKFTRRVSVCAETFNPDEEEDNDPRVVHPKTDEQRYRLQEACKDILLFKNLDQEQLSQVLDAMFEKIVKTDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNRGSFGELALMYNTPRAATIVATSDGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLFKSLEMSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIRSKTKTNKNGGNQEVEIAHCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSNLDLLDPGQ"
misc_feature 113..514 /gene="Prkar2a" /note="propagated from UniProtKB/Swiss-Prot (P12368.4); Region: Dimerization and phosphorylation" misc_feature 113..115 /gene="Prkar2a" /note="N-acetylserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); acetylation site" misc_feature 119..241 /gene="Prkar2a" /note="dimerization/docking (D/D) domain of the Type II alpha Regulatory subunit of cAMP-dependent protein kinase; Region: DD_RIIalpha_PKA; cd12103" /db_xref="CDD:438524" misc_feature order(119..133,137..139,146..151,158..163,170..175, 182..184,191..202,206..211,218..223,227..232) /gene="Prkar2a" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature order(125..127,137..142,149..154,161..166,173..178) /gene="Prkar2a" /note="AKAP interaction site [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature 251..253 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 272..364 /gene="Prkar2a" /note="propagated from UniProtKB/Swiss-Prot (P12368.4); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 332..334 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 338..340 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 398..400 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:16641100, ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 515..853 /gene="Prkar2a" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(719..724,749..757) /gene="Prkar2a" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature 743..745 /gene="Prkar2a" /note="Phosphothreonine, by PDPK1. /evidence=ECO:0000250|UniProtKB:P00515; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature order(815..823,833..841) /gene="Prkar2a" /note="flexible hinge region; other site" /db_xref="CDD:237999" misc_feature 881..1246 /gene="Prkar2a" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(1109..1114,1139..1147) /gene="Prkar2a" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature 1148..1150 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature order(1205..1213,1223..1231) /gene="Prkar2a" /note="flexible hinge region; other site" /db_xref="CDD:237999" misc_feature 1283..1285 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" exon 366..401 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 402..451 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 452..535 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 536..642 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 643..796 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 797..898 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 899..973 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 974..1039 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 1040..1181 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 1182..1541 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" ORIGIN
cgggccgcgcgggagacctcgggcgcggagtgactggccggcgtgagggagcgcgcaggttgcggccgccggcggccccgacccgccggccctctcagcggtcgccggcatgagccacatccagatcccaccggggctcacggagctgctgcagggctacaccgtggaggtgcttcggcagcagccgcccgacctcgtcgacttcgcggtggagtacttcacacgcctgcgcgaggcccgccgccaggaatcagactcgttcatcgcccccccgacgacctttcacgcgcaggagtccagcggggtccccgtcatcgaggaggacggggagagtgaatcggactcggacgatgaggatctggaagttccgattcccagcaaatttactagacgagtatcagtctgtgcagaaacgtttaaccctgatgaagaagaagataatgatccaagggtggttcaccccaaaaccgacgagcagaggtacagacttcaggaagcctgtaaagacattctgcttttcaaaaacctggatcaggaacagctttctcaagttctggacgccatgtttgaaaagatagtcaaaactgacgagcatgtcattgaccaaggagatgatggagacaacttttatgtcatagaaaggggaacctatgacattttagtaacaaaagataatcaaacacgatctgttggtcagtatgacaaccgtggcagttttggagaactagccctgatgtacaataccccgagagctgctaccattgtggccacctcagacggctccctttggggattggaccgggtgacttttaggagaatcatagtgaagaacaatgcaaagaagaggaagatgttcgaatcgtttattgagtctgtaccgctctttaaatcactagagatgtcagaacgaatgaagattgtggatgtgatcggggaaaagatctataaggatggagagcgaataatcactcagggtgaaaaggccgacagcttttatattatagagtctggagaagtgagcatcttgattagaagcaagactaaaacgaacaagaacggcgggaaccaggaggttgagattgcccactgccataaggggcagtactttggagaacttgccctggtgaccaacaaaccaagagctgcttctgcttatgcggttggagacgtcaaatgcttagtcatggatgttcaagcatttgagaggcttctgggcccctgcatggacatcatgaagaggaacatctcacattacgaagaacagctggtgaagatgtttggctccaacttggatctattggaccccgggcagtagatgtgatgaatctcggagccttctcagtgtgataccaaatccttccagtcagccacaagaacacacccagaaaacagacacgacagaactgcgcctgctgctgtctctgctgctgccatcgctgtggtaaagggcacttagaagtcttgaaagatggacagaggctctacccacacccaccttccactttgcttctgaacgccgtcattagaccacttatgtcacg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]