ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-18 22:37:52, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001194562 1062 bp mRNA linear PRI 10-JUL-2020 DEFINITION Macaca mulatta claudin 3 (CLDN3), mRNA. ACCESSION NM_001194562 XM_001112442 VERSION NM_001194562.2 KEYWORDS RefSeq. SOURCE Macaca mulatta (Rhesus monkey) ORGANISM Macaca mulatta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. REFERENCE 1 (bases 1 to 1062) AUTHORS Zimin AV, Cornish AS, Maudhoo MD, Gibbs RM, Zhang X, Pandey S, Meehan DT, Wipfler K, Bosinger SE, Johnson ZP, Tharp GK, Marcais G, Roberts M, Ferguson B, Fox HS, Treangen T, Salzberg SL, Yorke JA and Norgren RB Jr. TITLE A new rhesus macaque assembly and annotation for next-generation sequencing analyses JOURNAL Biol. Direct 9 (1), 20 (2014) PUBMED 25319552 REMARK Publication Status: Online-Only COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from QNVO02000311.1. On Dec 18, 2019 this sequence version replaced NM_001194562.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript is intronless :: JV635963.1, SRR5038768.208010.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1062 QNVO02000311.1 484560-485621 FEATURES Location/Qualifiers source 1..1062 /organism="Macaca mulatta" /mol_type="mRNA" /db_xref="taxon:9544" /chromosome="3" /map="3" gene 1..1062 /gene="CLDN3" /gene_synonym="claudin-3" /note="claudin 3" /db_xref="GeneID:716771" /db_xref="VGNC:VGNC:71250" exon 1..1062 /gene="CLDN3" /gene_synonym="claudin-3" /inference="alignment:Splign:2.1.0" misc_feature 118..120 /gene="CLDN3" /gene_synonym="claudin-3" /note="upstream in-frame stop codon" CDS 379..1041 /gene="CLDN3" /gene_synonym="claudin-3" /codon_start=1 /product="claudin-3" /protein_id="NP_001181491.1" /db_xref="GeneID:716771" /db_xref="VGNC:VGNC:71250" /translation="
MSMGLEITGTALAVLGWLGTIVCCALPMWRVTAFIGSNIITSQTIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIREFYNPVVPEAQKREMGTSLYVGWAAAALQLLGGALLCCSCPPREKKYMPTKVVYSAPRSTGPGASMGTAYDRKDYV"
misc_feature 385..879
/gene="CLDN3"
/gene_synonym="claudin-3"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; cl21598"
/db_xref="CDD:473919"
ORIGIN
gtccttcctcccagaacgctcggtgaaggtgggaggcaggggccacgtcactgtccccaggccctggagagcgctgctccgcccctcccgcccccaacggagcgctgggcacttagctaagacgcaccggccccagcccagggccagcccagtcgccgccgcccgcccgcaaagccacaggcaggtgcaggcgcagcctcggcgcgagtgtgtggagccgagccgttagcgcgcgccgtcggtgagtcagtccgtccgtccgtccgtccgtccgtctgtccgtcggggcgccgcagctcccaccaggcccagcggccccggcccctcgtctccccgcacccggagccacccggtggagtgggctttgccgcggcagccatgtccatgggcctggagatcacgggcaccgcgctggccgtgctgggctggctgggcaccatcgtgtgctgcgcgctgcccatgtggcgcgtgacggccttcatcggcagcaacatcatcacgtcgcagaccatctgggagggcctgtggatgaactgcgtggtgcagagcaccggccagatgcagtgcaaggtgtacgactcgctgctggcgctgccgcaggacctgcaggcggcccgcgccctcatcgtggtggccatcctgctggccgccttcgggctgctagtggcgctggtgggcgcccagtgcaccaactgcgtgcaggacgacacggccaaggccaagatcactatcgtggcgggcgtgctgttccttctggccgccctgctcaccctcgtgccggtgtcctggtccgccaacaccattatccgggaattctacaaccccgtggtgcctgaggcgcagaagcgcgagatgggcacgagcctgtacgtgggctgggcggccgcggcgctgcagctgctggggggcgcgctgctctgttgctcgtgccccccacgcgagaagaagtacatgcccaccaaggtcgtctactccgcgccgcgctccaccggcccgggagccagcatgggcacagcctacgaccgcaaggactatgtctaagggacagacgcagggagaccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]