LOCUS       NM_133514               1714 bp    mRNA    linear   ROD 29-MAR-2024
DEFINITION  Rattus norvegicus matrix metallopeptidase 10 (Mmp10), mRNA.
ACCESSION   NM_133514
VERSION     NM_133514.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1714)
  AUTHORS   Faraj Shaglouf,L.H., Ranjpour,M., Wajid,S. and Jain,S.K.
  TITLE     Elevated expression of cellular SYNE1, MMP10, and GTPase1 and their
            regulatory role in hepatocellular carcinoma progression
  JOURNAL   Protoplasma 257 (1), 157-167 (2020)
   PUBMED   31428857
  REMARK    GeneRIF: Elevated expression of cellular SYNE1, MMP10, and GTPase1
            and their regulatory role in hepatocellular carcinoma progression.
REFERENCE   2  (bases 1 to 1714)
  AUTHORS   Takamura,Y., Matsumoto,T., Tomomatsu,T., Matsumura,T., Takihara,Y.
            and Inatani,M.
  TITLE     Aldose reductase inhibitor counteracts the enhanced expression of
            matrix metalloproteinase-10 and improves corneal wound healing in
            galactose-fed rats
  JOURNAL   Mol Vis 19, 2477-2486 (2013)
   PUBMED   24339723
  REMARK    GeneRIF: MMP-10 modulates corneal epithelial wound healing.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1714)
  AUTHORS   Thibert,K.A., Raymond,G.V., Nascene,D.R., Miller,W.P., Tolar,J.,
            Orchard,P.J. and Lund,T.C.
  TITLE     Cerebrospinal fluid matrix metalloproteinases are elevated in
            cerebral adrenoleukodystrophy and correlate with MRI severity and
            neurologic dysfunction
  JOURNAL   PLoS One 7 (11), e50430 (2012)
   PUBMED   23185624
REFERENCE   4  (bases 1 to 1714)
  AUTHORS   Friese,R.S., Rao,F., Khandrika,S., Thomas,B., Ziegler,M.G.,
            Schmid-Schonbein,G.W. and O'Connor,D.T.
  TITLE     Matrix metalloproteinases: discrete elevations in essential
            hypertension and hypertensive end-stage renal disease
  JOURNAL   Clin Exp Hypertens 31 (7), 521-533 (2009)
   PUBMED   19886850
REFERENCE   5  (bases 1 to 1714)
  AUTHORS   Nishino,K., Yamanouchi,K., Naito,K. and Tojo,H.
  TITLE     Matrix metalloproteinases regulate mesonephric cell migration in
            developing XY gonads which correlates with the inhibition of tissue
            inhibitor of metalloproteinase-3 by Sry
  JOURNAL   Dev Growth Differ 44 (1), 35-43 (2002)
   PUBMED   11869290
REFERENCE   6  (bases 1 to 1714)
  AUTHORS   Saghizadeh,M., Brown,D.J., Castellon,R., Chwa,M., Huang,G.H.,
            Ljubimova,J.Y., Rosenberg,S., Spirin,K.S., Stolitenko,R.B.,
            Adachi,W., Kinoshita,S., Murphy,G., Windsor,L.J., Kenney,M.C. and
            Ljubimov,A.V.
  TITLE     Overexpression of matrix metalloproteinase-10 and matrix
            metalloproteinase-3 in human diabetic corneas: a possible mechanism
            of basement membrane and integrin alterations
  JOURNAL   Am J Pathol 158 (2), 723-734 (2001)
   PUBMED   11159210
REFERENCE   7  (bases 1 to 1714)
  AUTHORS   Chan,J.C., Scanlon,M., Zhang,H.Z., Jia,L.B., Yu,D.H., Hung,M.C.,
            French,M. and Eastman,E.M.
  TITLE     Molecular cloning and characterization of v-mos-activated
            transformation-associated proteins
  JOURNAL   J Biol Chem 267 (2), 1099-1103 (1992)
   PUBMED   1370458
REFERENCE   8  (bases 1 to 1714)
  AUTHORS   De Vouge,M.W. and Mukherjee,B.B.
  TITLE     Transformation of normal rat kidney cells by v-K-ras enhances
            expression of transin 2 and an S-100-related calcium-binding
            protein
  JOURNAL   Oncogene 7 (1), 109-119 (1992)
   PUBMED   1741158
REFERENCE   9  (bases 1 to 1714)
  AUTHORS   Breathnach,R., Matrisian,L.M., Gesnel,M.C., Staub,A. and Leroy,P.
  TITLE     Sequences coding for part of oncogene-induced transin are highly
            conserved in a related rat gene
  JOURNAL   Nucleic Acids Res 15 (3), 1139-1151 (1987)
   PUBMED   3547333
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000008.1.
            
            On Nov 24, 2020 this sequence version replaced NM_133514.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X05083.1, M65253.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760476,
                                           SAMN06621351 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-139               JAXUCZ010000008.1  12974707-12974845
            140-384             JAXUCZ010000008.1  12975482-12975726
            385-533             JAXUCZ010000008.1  12975818-12975966
            534-659             JAXUCZ010000008.1  12976407-12976532
            660-824             JAXUCZ010000008.1  12977667-12977831
            825-966             JAXUCZ010000008.1  12978377-12978518
            967-1100            JAXUCZ010000008.1  12979318-12979451
            1101-1260           JAXUCZ010000008.1  12980124-12980283
            1261-1364           JAXUCZ010000008.1  12980956-12981059
            1365-1714           JAXUCZ010000008.1  12982264-12982613
FEATURES             Location/Qualifiers
     source          1..1714
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q11"
     gene            1..1714
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="matrix metallopeptidase 10"
                     /db_xref="GeneID:117061"
                     /db_xref="RGD:620192"
     exon            1..139
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    5..7
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="upstream in-frame stop codon"
     CDS             35..1465
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /EC_number="3.4.24.22"
                     /note="stromelysin-2; transin-2; matrix
                     metalloproteinase-10; transformation-associated protein
                     34A"
                     /codon_start=1
                     /product="stromelysin-2 precursor"
                     /protein_id="NP_598198.2"
                     /db_xref="GeneID:117061"
                     /db_xref="RGD:620192"
                     /translation="

MEPLAILVLLCFPICSAYPLHGAVRQDHSTMDLAQQYLEKYYNFRKNEKQFFKRKDSSPVVKKIEEMQKFLGLEMTGKLDSNTVEMMHKPRCGVPDVGGFSTFPGSPKWRKNHISYRIVNYTLDLPRESVDSAIERALKVWEEVTPLTFSRISEGEADIMISFAVGEHGDFYPFDGVGQSLAHAYPPGPGFYGDAHFDDDEKWSLGPSGTNLFLVAAHELGHSLGLFHSNNKESLMYPVYRFSTSQANIRLSQDDIEGIQSLYGARPSSDATVVPVPSVSPKPETPVKCDPALSFDAVTMLRGEFLFFKDRHFWRRTQWNPEPEFHLISAFWPSLPSGLDAAYEANNKDRVLIFKGSQFWAVRGNEVQAGYPKRIHTLGFPPTVKKIDAAVFEKEKKKTYFFVGDKYWRFDETRQLMDKGFPRLITDDFPGIEPQVDAVLHAFGFFYFFRGSSQFEFDPNARTVTHTLKSNSWLLC"

     sig_peptide     35..85
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    131..295
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Putative peptidoglycan binding domain; Region:
                     PG_binding_1; pfam01471"
                     /db_xref="CDD:460223"
     misc_feature    302..325
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Cysteine switch. /evidence=ECO:0000250"
     mat_peptide     332..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /product="Stromelysin-2. /id=PRO_0000028769"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1)"
     misc_feature    356..826
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Matrixin; Region: Peptidase_M10; pfam00413"
                     /db_xref="CDD:425668"
     misc_feature    890..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Hemopexin-like repeats.; Hemopexin is a
                     heme-binding protein that transports heme to the liver.
                     Hemopexin-like repeats occur in vitronectin and some
                     matrix metalloproteinases family (matrixins). The HX
                     repeats of some matrixins bind tissue inhibitor of...;
                     Region: HX; cd00094"
                     /db_xref="CDD:238046"
     misc_feature    890..1039
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 1"
     misc_feature    order(920..922,926..928,1052..1054,1058..1060,1196..1198,
                     1202..1204,1343..1345,1349..1351)
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Metal binding sites [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238046"
     misc_feature    1040..1180
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 2"
     misc_feature    1184..1330
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 3"
     misc_feature    1331..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 4"
     exon            140..384
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            385..533
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            534..659
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            660..824
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            825..966
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            967..1100
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1101..1260
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1261..1364
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1365..1714
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

aagttaggtgctacagaaggtaaaggctgtctctatggagccactggccatcctggtgctgctgtgctttccgatctgctcagcatatcctctgcatggggcagtgagacaagaccactcaaccatggatcttgctcagcaatacctagaaaaatactacaactttagaaaaaatgagaaacaatttttcaaaagaaaggacagtagtcctgttgtcaaaaaaattgaagaaatgcagaagttccttgggctggagatgacagggaagctggactcgaacactgtggagatgatgcacaagccccggtgtggtgttcccgacgtcggtggcttcagtacctttccaggttcacccaaatggaggaaaaaccacatctcctacaggattgtgaattatacactggatttaccaagagagagtgtggattctgccattgagagagctttgaaggtctgggaggaggtgaccccactcacattctccaggatctctgaaggagaggctgacataatgatctcctttgcagttggagaacatggagacttttacccttttgatggagtgggacagagcttggctcatgcctacccacctggccctggattttatggagatgctcacttcgatgatgatgagaaatggtcactgggaccctcagggaccaatttattcctggttgctgcgcatgaacttggtcactccctgggtctctttcactcaaacaacaaagaatctctgatgtacccagtctacaggttctccacgagccaagccaacattcgcctttctcaggatgatatagagggcattcaatccctgtatggagcccgcccctcctctgatgccacagtggttcctgtgccctctgtctctccaaaacctgagaccccagtcaaatgtgatcctgctttgtcctttgatgcagtcaccatgctgagaggggaattcctattctttaaagacaggcacttctggcgtagaacccagtggaatcccgagcctgaattccatttgatttcagcattttggccctctcttccttcaggcttagatgctgcctatgaggcaaataacaaggacagagttctgatttttaaaggaagtcagttctgggcagtccgaggaaatgaagtccaagcaggttacccaaagaggatccacactcttggctttcctcccaccgtgaagaagattgatgcagctgtttttgaaaaggagaagaagaagacgtatttctttgtaggtgacaaatactggagatttgatgagacaagacagcttatggataaaggcttcccgagactgataacagatgacttcccaggaattgagccacaagttgatgctgtgttacatgcatttgggtttttttatttcttccgtggatcatcacagttcgagtttgaccccaatgccaggacggtgacacacacactgaagagcaacagctggctgttgtgctgattatcatgatgacaagacatatacaacactgtaaaatagtatttctcgcctaatttattatgtgtcataatgatgaattgttcctgcatgtgctgtggctcgagatgagcccagcagatagatgtctttcttaatgaaccacagagcatcacctgagcacagaagtgaaagcttctcggtacactaggtgagaggatgcatccccatgggtactttattgtttaataaagaactttatttttgaaccat

//