2024-11-01 08:18:07, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_031142 1800 bp mRNA linear ROD 30-JUL-2024 DEFINITION Rattus norvegicus double C2 domain beta (Doc2b), mRNA. ACCESSION NM_031142 VERSION NM_031142.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1800) AUTHORS Brouwer,I., Giniatullina,A., Laurens,N., van Weering,J.R.T., Bald,D., Wuite,G.J.L. and Groffen,A.J. TITLE Direct quantitative detection of Doc2b-induced hemifusion in optically trapped membranes JOURNAL Nat Commun 6, 8387 (2015) PUBMED 26395669 REMARK GeneRIF: acts directly on membranes and stabilizes hemifusion intermediate in cell-free system Publication Status: Online-Only REFERENCE 2 (bases 1 to 1800) AUTHORS Xue,R., Gaffaney,J.D. and Chapman,E.R. TITLE Structural elements that underlie Doc2beta function during asynchronous synaptic transmission JOURNAL Proc Natl Acad Sci U S A 112 (31), E4316-E4325 (2015) PUBMED 26195798 REMARK GeneRIF: these data reveal the key determinants of Doc2beta that underlie its function during the slow phase of synaptic transmission. REFERENCE 3 (bases 1 to 1800) AUTHORS Gaffaney,J.D., Xue,R. and Chapman,E.R. TITLE Mutations that disrupt Ca(2)-binding activity endow Doc2beta with novel functional properties during synaptic transmission JOURNAL Mol Biol Cell 25 (4), 481-494 (2014) PUBMED 24356452 REMARK GeneRIF: Mutations that disrupt Ca(2)-binding activity endow Doc2beta with novel functional properties during synaptic transmission. REFERENCE 4 (bases 1 to 1800) AUTHORS Yu,H., Rathore,S.S., Davis,E.M., Ouyang,Y. and Shen,J. TITLE Doc2b promotes GLUT4 exocytosis by activating the SNARE-mediated fusion reaction in a calcium- and membrane bending-dependent manner JOURNAL Mol Biol Cell 24 (8), 1176-1184 (2013) PUBMED 23427263 REMARK GeneRIF: Doc2b exocytotic functions appear to be distinct from how synaptotagmin-1 promotes synaptic neurotransmitter release. REFERENCE 5 (bases 1 to 1800) AUTHORS Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R. TITLE Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter release JOURNAL Cell 147 (3), 666-677 (2011) PUBMED 22036572 REFERENCE 6 (bases 1 to 1800) AUTHORS Ke,B., Oh,E. and Thurmond,D.C. TITLE Doc2beta is a novel Munc18c-interacting partner and positive effector of syntaxin 4-mediated exocytosis JOURNAL J Biol Chem 282 (30), 21786-21797 (2007) PUBMED 17548353 REFERENCE 7 (bases 1 to 1800) AUTHORS Korteweg,N., Denekamp,F.A., Verhage,M. and Burbach,J.P. TITLE Different spatiotemporal expression of DOC2 genes in the developing rat brain argues for an additional, nonsynaptic role of DOC2B in early development JOURNAL Eur J Neurosci 12 (1), 165-171 (2000) PUBMED 10651871 REFERENCE 8 (bases 1 to 1800) AUTHORS Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M., Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y. TITLE Interaction of Doc2 with tctex-1, a light chain of cytoplasmic dynein. Implication in dynein-dependent vesicle transport JOURNAL J Biol Chem 273 (46), 30065-30068 (1998) PUBMED 9804756 REFERENCE 9 (bases 1 to 1800) AUTHORS Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and Sudhof,T.C. TITLE DOC2 proteins in rat brain: complementary distribution and proposed function as vesicular adapter proteins in early stages of secretion JOURNAL Neuron 18 (3), 453-461 (1997) PUBMED 9115738 REFERENCE 10 (bases 1 to 1800) AUTHORS Kojima,T., Fukuda,M., Aruga,J. and Mikoshiba,K. TITLE Calcium-dependent phospholipid binding to the C2A domain of a ubiquitous form of double C2 protein (Doc2 beta) JOURNAL J Biochem 120 (3), 671-676 (1996) PUBMED 8902635 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from U70778.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U70778.2 [ECO:0000332] RNAseq introns :: mixed sample support SAMD00132261, SAMD00132262 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1800 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="10" /map="10q24" gene 1..1800 /gene="Doc2b" /note="double C2 domain beta" /db_xref="GeneID:81820" /db_xref="RGD:620519" exon 1..528 /gene="Doc2b" /inference="alignment:Splign:2.1.0" CDS 156..1394 /gene="Doc2b" /function="probably functions in vesicular trafficking" /note="doc2-beta; double C2, beta; double C2-like domains, beta" /codon_start=1 /product="double C2-like domain-containing protein beta" /protein_id="NP_112404.1" /db_xref="GeneID:81820" /db_xref="RGD:620519" /translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPTAAPRASAPPDAPARSPAATAGPRSPSDGARDDDEDVDQLFGAYGASPGPSPGPSPVRPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTISKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPSWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKAEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLKPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKTLEVTVWDYDIGKSNDFIGGVVLGINAKGERLKHWFDCLKNKDKRIERWHTLTNEIPGAVLSD"
misc_feature 156..425 /gene="Doc2b" /note="propagated from UniProtKB/Swiss-Prot (P70610.2); Region: Mediates interaction with DYNLT1. /evidence=ECO:0000250" misc_feature 156..263 /gene="Doc2b" /note="propagated from UniProtKB/Swiss-Prot (P70610.2); Region: Negatively regulates targeting to plasma membrane. /evidence=ECO:0000250" misc_feature 216..>413 /gene="Doc2b" /note="large tegument protein UL36; Provisional; Region: PHA03247" /db_xref="CDD:223021" misc_feature 267..524 /gene="Doc2b" /note="propagated from UniProtKB/Swiss-Prot (P70610.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 534..905 /gene="Doc2b" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(624..626,642..644,807..809,813..815,831..833) /gene="Doc2b" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 924..1280 /gene="Doc2b" /note="propagated from UniProtKB/Swiss-Prot (P70610.2); Region: Mediates interaction with STXBP3. /evidence=ECO:0000250" misc_feature 960..1358 /gene="Doc2b" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(1044..1046,1062..1064,1224..1226,1230..1232, 1248..1250) /gene="Doc2b" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" misc_feature 1386..1388 /gene="Doc2b" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P70610.2); phosphorylation site" exon 529..608 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 609..683 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 684..793 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 794..920 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 921..1078 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 1079..1160 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 1161..1257 /gene="Doc2b" /inference="alignment:Splign:2.1.0" exon 1258..1800 /gene="Doc2b" /inference="alignment:Splign:2.1.0" ORIGIN
gccgccgccgagcaggcagcagccgcgtcagggccgtccgggggccacaccggcgatgcccgcagcccccgcagcgccccgcgggacccgctgacttacccccgggccggggtcataccgggccgggccgggccgcgagcggcggcgctgcctgcatgaccctccggaggcgcggggagaaggcgaccatcagcatccaagagcatatggccatcgacgtgtgtcccgggcccatccggcctatcaagcagatctccgattacttcccccgcttcccgcggggcctcccccccaccgccgcgccccgcgcctccgcgcccccggacgcccccgcgcgctcgcccgcagccaccgccggcccccgcagcccctccgacggcgcccgcgacgacgacgaagatgtggaccagctcttcggagcctacggtgccagcccaggccccagccccggacccagccccgtgaggccgccggccaagccccccgaggacgaaccggacgccgacggctacgagtcagacgactgcaccgccctgggtacactggacttcagtctgctctatgaccaggagaacaacgcactgcactgcaccatcagcaaagccaagggcctgaagccgatggatcacaatggactggctgatccctacgtcaaactacacttgctgcctggagccagcaaggcaaataagctcagaacaaaaaccctacggaacactctgaacccctcctggaacgagaccctcacctattacgggatcacggatgaggacatgatccgaaagaccctgaggatctccgtgtgtgacgaggacaaattccgccacaacgagttcatcggagagactcgagtgcccctgaagaagctgaaacccaaccacaccaagacattcagcatctgcctggagaagcagctgccggtggacaaggcagaggacaagtccctggaggagcgtggccgcatcctcatctctctcaagtacagctcacagaagcagggcctgctggtgggcatcgttcgctgcgcacacctggcggccatggatgctaacggctactcagacccctacgtgaaaacatatctgaaaccagatgtagacaagaaatccaagcataagaccgcagtcaagaagaaaacactaaaccctgaattcaatgaggagttctgttacgagatcaagcatggagacctagccaaaaagaccctggaggtcactgtctgggactatgatattggaaaatccaatgatttcatcggtggggtggttctgggcatcaatgccaagggtgagcgcctgaagcactggtttgactgtctgaagaacaaggacaagaggattgagcgttggcacacgctcaccaatgagatcccaggggctgtactcagcgactgactgtcccatctgctgccacccacccttgccacccagcccacacaggtccaaccctgggctttctcagctgccaccaagggctgtggccctcacaatgggcaagatccaggttgtctgctcggacatagccactgcagcccctgctaggaggctaggaggccaagagcacccagcctctcgcagagggacaggaaaacacaacatgaaacctgtttcagctcccctggcaccccaaagggccagagctgggagaaatcctcagcctcagctctgtccagtggaagggctatctacagtgaggacctatcagaggtgaggggtggaaccctgctgcaagcacagaaatgggggtactctggctacctggagaccacagagggaggactatgggcaggcagagcccagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]