GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 08:18:07, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_031142               1800 bp    mRNA    linear   ROD 30-JUL-2024
DEFINITION  Rattus norvegicus double C2 domain beta (Doc2b), mRNA.
ACCESSION   NM_031142
VERSION     NM_031142.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1800)
  AUTHORS   Brouwer,I., Giniatullina,A., Laurens,N., van Weering,J.R.T.,
            Bald,D., Wuite,G.J.L. and Groffen,A.J.
  TITLE     Direct quantitative detection of Doc2b-induced hemifusion in
            optically trapped membranes
  JOURNAL   Nat Commun 6, 8387 (2015)
   PUBMED   26395669
  REMARK    GeneRIF: acts directly on membranes and stabilizes hemifusion
            intermediate in cell-free system
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1800)
  AUTHORS   Xue,R., Gaffaney,J.D. and Chapman,E.R.
  TITLE     Structural elements that underlie Doc2beta function during
            asynchronous synaptic transmission
  JOURNAL   Proc Natl Acad Sci U S A 112 (31), E4316-E4325 (2015)
   PUBMED   26195798
  REMARK    GeneRIF: these data reveal the key determinants of Doc2beta that
            underlie its function during the slow phase of synaptic
            transmission.
REFERENCE   3  (bases 1 to 1800)
  AUTHORS   Gaffaney,J.D., Xue,R. and Chapman,E.R.
  TITLE     Mutations that disrupt Ca(2)-binding activity endow Doc2beta with
            novel functional properties during synaptic transmission
  JOURNAL   Mol Biol Cell 25 (4), 481-494 (2014)
   PUBMED   24356452
  REMARK    GeneRIF: Mutations that disrupt Ca(2)-binding activity endow
            Doc2beta with novel functional properties during synaptic
            transmission.
REFERENCE   4  (bases 1 to 1800)
  AUTHORS   Yu,H., Rathore,S.S., Davis,E.M., Ouyang,Y. and Shen,J.
  TITLE     Doc2b promotes GLUT4 exocytosis by activating the SNARE-mediated
            fusion reaction in a calcium- and membrane bending-dependent manner
  JOURNAL   Mol Biol Cell 24 (8), 1176-1184 (2013)
   PUBMED   23427263
  REMARK    GeneRIF: Doc2b exocytotic functions appear to be distinct from how
            synaptotagmin-1 promotes synaptic neurotransmitter release.
REFERENCE   5  (bases 1 to 1800)
  AUTHORS   Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R.
  TITLE     Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
            release
  JOURNAL   Cell 147 (3), 666-677 (2011)
   PUBMED   22036572
REFERENCE   6  (bases 1 to 1800)
  AUTHORS   Ke,B., Oh,E. and Thurmond,D.C.
  TITLE     Doc2beta is a novel Munc18c-interacting partner and positive
            effector of syntaxin 4-mediated exocytosis
  JOURNAL   J Biol Chem 282 (30), 21786-21797 (2007)
   PUBMED   17548353
REFERENCE   7  (bases 1 to 1800)
  AUTHORS   Korteweg,N., Denekamp,F.A., Verhage,M. and Burbach,J.P.
  TITLE     Different spatiotemporal expression of DOC2 genes in the developing
            rat brain argues for an additional, nonsynaptic role of DOC2B in
            early development
  JOURNAL   Eur J Neurosci 12 (1), 165-171 (2000)
   PUBMED   10651871
REFERENCE   8  (bases 1 to 1800)
  AUTHORS   Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M.,
            Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y.
  TITLE     Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
            dynein. Implication in dynein-dependent vesicle transport
  JOURNAL   J Biol Chem 273 (46), 30065-30068 (1998)
   PUBMED   9804756
REFERENCE   9  (bases 1 to 1800)
  AUTHORS   Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and
            Sudhof,T.C.
  TITLE     DOC2 proteins in rat brain: complementary distribution and proposed
            function as vesicular adapter proteins in early stages of secretion
  JOURNAL   Neuron 18 (3), 453-461 (1997)
   PUBMED   9115738
REFERENCE   10 (bases 1 to 1800)
  AUTHORS   Kojima,T., Fukuda,M., Aruga,J. and Mikoshiba,K.
  TITLE     Calcium-dependent phospholipid binding to the C2A domain of a
            ubiquitous form of double C2 protein (Doc2 beta)
  JOURNAL   J Biochem 120 (3), 671-676 (1996)
   PUBMED   8902635
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from U70778.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U70778.2 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMD00132261,
                                           SAMD00132262 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1800
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q24"
     gene            1..1800
                     /gene="Doc2b"
                     /note="double C2 domain beta"
                     /db_xref="GeneID:81820"
                     /db_xref="RGD:620519"
     exon            1..528
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     CDS             156..1394
                     /gene="Doc2b"
                     /function="probably functions in vesicular trafficking"
                     /note="doc2-beta; double C2, beta; double C2-like domains,
                     beta"
                     /codon_start=1
                     /product="double C2-like domain-containing protein beta"
                     /protein_id="NP_112404.1"
                     /db_xref="GeneID:81820"
                     /db_xref="RGD:620519"
                     /translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPTAAPRASAPPDAPARSPAATAGPRSPSDGARDDDEDVDQLFGAYGASPGPSPGPSPVRPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTISKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPSWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKAEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLKPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKTLEVTVWDYDIGKSNDFIGGVVLGINAKGERLKHWFDCLKNKDKRIERWHTLTNEIPGAVLSD"
     misc_feature    156..425
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Mediates interaction with DYNLT1.
                     /evidence=ECO:0000250"
     misc_feature    156..263
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Negatively regulates targeting to plasma membrane.
                     /evidence=ECO:0000250"
     misc_feature    216..>413
                     /gene="Doc2b"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    267..524
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    534..905
                     /gene="Doc2b"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(624..626,642..644,807..809,813..815,831..833)
                     /gene="Doc2b"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    924..1280
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Mediates interaction with STXBP3.
                     /evidence=ECO:0000250"
     misc_feature    960..1358
                     /gene="Doc2b"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(1044..1046,1062..1064,1224..1226,1230..1232,
                     1248..1250)
                     /gene="Doc2b"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     misc_feature    1386..1388
                     /gene="Doc2b"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P70610.2); phosphorylation site"
     exon            529..608
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            609..683
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            684..793
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            794..920
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            921..1078
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1079..1160
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1161..1257
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1258..1800
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gccgccgccgagcaggcagcagccgcgtcagggccgtccgggggccacaccggcgatgcccgcagcccccgcagcgccccgcgggacccgctgacttacccccgggccggggtcataccgggccgggccgggccgcgagcggcggcgctgcctgcatgaccctccggaggcgcggggagaaggcgaccatcagcatccaagagcatatggccatcgacgtgtgtcccgggcccatccggcctatcaagcagatctccgattacttcccccgcttcccgcggggcctcccccccaccgccgcgccccgcgcctccgcgcccccggacgcccccgcgcgctcgcccgcagccaccgccggcccccgcagcccctccgacggcgcccgcgacgacgacgaagatgtggaccagctcttcggagcctacggtgccagcccaggccccagccccggacccagccccgtgaggccgccggccaagccccccgaggacgaaccggacgccgacggctacgagtcagacgactgcaccgccctgggtacactggacttcagtctgctctatgaccaggagaacaacgcactgcactgcaccatcagcaaagccaagggcctgaagccgatggatcacaatggactggctgatccctacgtcaaactacacttgctgcctggagccagcaaggcaaataagctcagaacaaaaaccctacggaacactctgaacccctcctggaacgagaccctcacctattacgggatcacggatgaggacatgatccgaaagaccctgaggatctccgtgtgtgacgaggacaaattccgccacaacgagttcatcggagagactcgagtgcccctgaagaagctgaaacccaaccacaccaagacattcagcatctgcctggagaagcagctgccggtggacaaggcagaggacaagtccctggaggagcgtggccgcatcctcatctctctcaagtacagctcacagaagcagggcctgctggtgggcatcgttcgctgcgcacacctggcggccatggatgctaacggctactcagacccctacgtgaaaacatatctgaaaccagatgtagacaagaaatccaagcataagaccgcagtcaagaagaaaacactaaaccctgaattcaatgaggagttctgttacgagatcaagcatggagacctagccaaaaagaccctggaggtcactgtctgggactatgatattggaaaatccaatgatttcatcggtggggtggttctgggcatcaatgccaagggtgagcgcctgaagcactggtttgactgtctgaagaacaaggacaagaggattgagcgttggcacacgctcaccaatgagatcccaggggctgtactcagcgactgactgtcccatctgctgccacccacccttgccacccagcccacacaggtccaaccctgggctttctcagctgccaccaagggctgtggccctcacaatgggcaagatccaggttgtctgctcggacatagccactgcagcccctgctaggaggctaggaggccaagagcacccagcctctcgcagagggacaggaaaacacaacatgaaacctgtttcagctcccctggcaccccaaagggccagagctgggagaaatcctcagcctcagctctgtccagtggaagggctatctacagtgaggacctatcagaggtgaggggtggaaccctgctgcaagcacagaaatgggggtactctggctacctggagaccacagagggaggactatgggcaggcagagcccagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]