GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 08:27:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_020102               1308 bp    mRNA    linear   ROD 31-MAR-2024
DEFINITION  Rattus norvegicus MOS proto-oncogene, serine/threonine kinase
            (Mos), mRNA.
ACCESSION   NM_020102 XM_346731
VERSION     NM_020102.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1308)
  AUTHORS   Suzuki,T., Suzuki,E., Yoshida,N., Kubo,A., Li,H., Okuda,E.,
            Amanai,M. and Perry,A.C.
  TITLE     Mouse Emi2 as a distinctive regulatory hub in second meiotic
            metaphase
  JOURNAL   Development 137 (19), 3281-3291 (2010)
   PUBMED   20724447
REFERENCE   2  (bases 1 to 1308)
  AUTHORS   Perrard,M.H., Chassaing,E., Montillet,G., Sabido,O. and Durand,P.
  TITLE     Cytostatic factor proteins are present in male meiotic cells and
            beta-nerve growth factor increases mos levels in rat late
            spermatocytes
  JOURNAL   PLoS One 4 (10), e7237 (2009)
   PUBMED   19802389
  REMARK    GeneRIF: NGF, by enhancing Mos in late spermatocytes, is one of the
            intra-testicular factors which adjusts the number of round
            spermatids that can be supported by Sertoli cells
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1308)
  AUTHORS   Nishimura,T., Shimaoka,T., Kano,K. and Naito,K.
  TITLE     Insufficient amount of Cdc2 and continuous activation of Wee1 B are
            the cause of meiotic failure in porcine growing oocytes
  JOURNAL   J Reprod Dev 55 (5), 553-557 (2009)
   PUBMED   19550110
REFERENCE   4  (bases 1 to 1308)
  AUTHORS   Ohashi,S., Naito,K., Sugiura,K., Iwamori,N., Goto,S., Naruoka,H.
            and Tojo,H.
  TITLE     Analyses of mitogen-activated protein kinase function in the
            maturation of porcine oocytes
  JOURNAL   Biol Reprod 68 (2), 604-609 (2003)
   PUBMED   12533425
REFERENCE   5  (bases 1 to 1308)
  AUTHORS   Kim,M.H., Yuan,X., Okumura,S. and Ishikawa,F.
  TITLE     Successful inactivation of endogenous Oct-3/4 and c-mos genes in
            mouse preimplantation embryos and oocytes using short interfering
            RNAs
  JOURNAL   Biochem Biophys Res Commun 296 (5), 1372-1377 (2002)
   PUBMED   12207927
REFERENCE   6  (bases 1 to 1308)
  AUTHORS   Colledge,W.H., Carlton,M.B., Udy,G.B. and Evans,M.J.
  TITLE     Disruption of c-mos causes parthenogenetic development of
            unfertilized mouse eggs
  JOURNAL   Nature 370 (6484), 65-68 (1994)
   PUBMED   8015609
REFERENCE   7  (bases 1 to 1308)
  AUTHORS   Sonakul,D. and Fucharoen,S.
  TITLE     Brain pathology in 6 fatal cases of post-transfusion hypertension,
            convulsion and cerebral hemorrhage syndrome
  JOURNAL   Southeast Asian J Trop Med Public Health 23 Suppl 2, 116-119 (1992)
   PUBMED   1298984
  REMARK    Review article
REFERENCE   8  (bases 1 to 1308)
  AUTHORS   Leibovitch,S.A., Lenormand,J.L., Leibovitch,M.P., Guiller,M.,
            Mallard,L. and Harel,J.
  TITLE     Rat myogenic c-mos cDNA: cloning sequence analysis and regulation
            during muscle development
  JOURNAL   Oncogene 5 (8), 1149-1157 (1990)
   PUBMED   1697408
REFERENCE   9  (bases 1 to 1308)
  AUTHORS   van der Hoorn,F.A. and Firzlaff,J.
  TITLE     Complete c-mos (rat) nucleotide sequence: presence of conserved
            domains in c-mos proteins
  JOURNAL   Nucleic Acids Res 12 (4), 2147-2156 (1984)
   PUBMED   6322135
REFERENCE   10 (bases 1 to 1308)
  AUTHORS   Williams,A.F., Barclay,A.N., Letarte-Muirhead,M. and Morris,R.J.
  TITLE     Rat thy-1 antigens from thymus and brain: their tissue
            distribution, purification, and chemical composition
  JOURNAL   Cold Spring Harb Symp Quant Biol 41 Pt 1, 51-61 (1977)
   PUBMED   70317
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000005.1.
            
            On Sep 20, 2014 this sequence version replaced NM_020102.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: X52952.1, SRR26360190.1163247.1
                                        [ECO:0000345]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1308              JAXUCZ010000005.1  21657549-21658856   c
FEATURES             Location/Qualifiers
     source          1..1308
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5q12"
     gene            1..1308
                     /gene="Mos"
                     /note="MOS proto-oncogene, serine/threonine kinase"
                     /db_xref="GeneID:24559"
                     /db_xref="RGD:3103"
     exon            1..1308
                     /gene="Mos"
                     /inference="alignment:Splign:2.1.0"
     CDS             171..1199
                     /gene="Mos"
                     /EC_number="2.7.11.1"
                     /note="c-mos; oocyte maturation factor mos; proto-oncogene
                     c-Mos; v-mos moloney murine sarcoma viral oncogene
                     homolog; Moloney murine sarcoma viral (v-mos) oncogene
                     homolog; Moloney sarcoma oncogene"
                     /codon_start=1
                     /product="proto-oncogene serine/threonine-protein kinase
                     mos"
                     /protein_id="NP_064487.3"
                     /db_xref="GeneID:24559"
                     /db_xref="RGD:3103"
                     /translation="
MPSPLILCRYLPRELSPTVDSRSCSSPLVASRKAGKFLGATPPRAPRLSRRLAWCFIDWGQVCLLHRLGSGGFGSVYKATYHGVPVAIKQVNKCTRNLRASQRSFWAELNIARLHHDNIVRVVAASTRTPEGSNSLGTIIMEFGGNVTLHQVIYGATRSPEPLSCREQLSLGKCLKYSLDIVNGLLFLHSQSILHLDLKPANILISEKDVCKISDFGCSQKLQDLRCRQASLHHIGGTYTHQAPELLKGEIATPKADIYSFGITLWQMTTREVPYSGEPQYVQYAVVAYNLRPSLAGAVFTASLTGKTLQNIVQSCWEARALQRPGAELLQKDLKAFRGALG"
     misc_feature    342..1157
                     /gene="Mos"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     Oocyte maturation factor Mos; Region: STKc_Mos; cd13979"
                     /db_xref="CDD:270881"
     misc_feature    order(372..386,396..398,429..431,435..437,528..530,
                     591..602,612..614,618..620,759..761,765..767,771..776,
                     780..782,813..815,822..824,879..890)
                     /gene="Mos"
                     /note="active site"
                     /db_xref="CDD:270881"
     misc_feature    order(372..386,396..398,429..431,435..437,528..530,
                     591..602,612..614,759..761,765..767,771..776,780..782,
                     813..815)
                     /gene="Mos"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270881"
     misc_feature    order(384..386,612..614,618..620,759..761,765..767,
                     771..773,822..824,879..890)
                     /gene="Mos"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270881"
     misc_feature    order(810..857,870..890)
                     /gene="Mos"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270881"
ORIGIN      
accttgctgagcagcaagacgtgagagcacagttgtggctggttttgagaatacaagaagaagggaaatgggatgaaggcggaaaccttcagccatgcttccaaacttccctgggtgttcctggtcatttctctctagcgtctcttgtgactgtcccatctgagggtgtaatgccttcgcctctcatcctgtgtcgctacctccctcgcgagctgtcgccaacggtggactcgaggtcctgcagcagccccttggtggcctcgaggaaggcggggaagttcctgggggccactcctcctcgggccccgcggctgtcacgccggctggcctggtgcttcatagactggggacaggtatgcctgctgcataggctgggttctggagggtttggctcggtgtacaaagccacttaccacggtgttcctgtggccatcaagcaagtgaacaagtgcaccaggaacctacgtgcatcccagcggagtttctgggctgaactgaacattgcaaggctgcaccacgacaacatagtccgggttgtggctgccagcacgcgcacgccggaaggttccaacagccttggtaccataatcatggagtttgggggcaatgtgactctacaccaagtcatctacggtgccacccgctccccagagcctctcagctgcagagagcaactgagtttgggaaagtgcctcaagtattccctagatattgttaacggcctgctttttctccactcacaaagcattttgcacttggacctgaagccagcgaacattttgatcagtgagaaggacgtttgtaagataagtgacttcggctgctcccagaagcttcaggatctgcggtgccggcaggcgtcccttcaccacatcgggggcacgtacacgcaccaagctccggagctcctgaaaggagagatcgccacgcccaaagccgacatctactcttttggcatcaccctgtggcagatgaccaccagggaggtgccttactccggcgagcctcagtacgtgcagtacgcagtggtagcctacaatctgcgcccgtcactggcaggggcggtgttcaccgcctccctgactgggaagacgctgcagaacatcgtccagagctgctgggaggcccgcgccctgcagaggccgggtgcagaactgctccagaaggacctgaaggctttccgaggggcactgggctgactccatcgagcctgtgtgcagataagcttttcgtttctgtttatttttaaataagtaaggatgggcttttagggcatatttttagaaaataaagttactacaaacttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]