2024-05-06 17:36:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039108542 1534 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus uncharacterized LOC120102195 (LOC120102195), transcript variant X2, mRNA. ACCESSION XM_039108542 VERSION XM_039108542.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051339.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1534 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="4" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..1534 /gene="LOC120102195" /note="uncharacterized LOC120102195; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 18 samples with support for all annotated introns" /db_xref="GeneID:120102195" /db_xref="RGD:41279385" CDS 591..1490 /gene="LOC120102195" /codon_start=1 /product="uncharacterized protein LOC120102195 isoform X2" /protein_id="XP_038964470.1" /db_xref="GeneID:120102195" /db_xref="RGD:41279385" /translation="
MAECKRLNVYTDSRYAFATAHIHGKIYRRRGLLTSEGKDIKNKTEILAFLAALFLQKRLSIIHCPGHQKGHSPEARGNRLTDISAREAAMGTQVLSLKDQDQPTSPQPEQTSWLYTTEDTKLLQKMGAVWYPQLKRWVYTGKTVMPTKMTFELISYLHKLTHLGLKKMKTLLRQEEIDTYLLGRDQALREVTESCRACAQVNPGKAKIGQGVRPRGHWPGTHWEIDFTEIKPGMFGHKYLLVFIDTFSGWIEAFPTKHEMAKVVTKKLLEEIFPSTSSGPTNRAERHLETSSRGLPRQA"
misc_feature <591..857 /gene="LOC120102195" /note="Ribonuclease H-like superfamily, including RNase H, HI, HII, HIII, and RNase-like domain IV of spliceosomal protein Prp8; Region: RNase_H_like; cl14782" /db_xref="CDD:449355" misc_feature 933..1208 /gene="LOC120102195" /note="His(2)-Cys(2) zinc finger; Region: zf-H2C2; cl07828" /db_xref="CDD:447530" misc_feature 1245..>1409 /gene="LOC120102195" /note="Integrase core domain; Region: rve; pfam00665" /db_xref="CDD:425808" ORIGIN
tgtatgctaagggggtcctaacacaaagactgggaccctggaagcgcctggtagcctacctgtctaagaaattagaccctgtggcctccggttggccaccatgcctgagaatggtggcagccattaccgtcctaaccaaagacgctgggaagttgaccttggggcagccactcaccatcctggcacctcatgcagtggaggctttgataaaacagccccctgaccactggctctctaattcccgcatgacccactaccaagccttgctactggatgcggaacgggtccagtttaggcccgtggtcgctctcaacccagccactctgcttcctttgccagaggaggcagaacagcacgactgtccgcagatccttgcagaagtacatggaaccagaccagacctatcggactgacctctccaggatgctgaccatacgtggtacaccgatggtagcagctacttggtgaacggggaacggaaagctggagccgcggtcactacggagtgcaaagtgatctgggcaagtgccttgccagctggtacctccgcacagtgggctgaactcattgccttaactcaggtgctcaaaatggcagaatgtaagaggctgaatgtatatacagacagccgctacgcctttgctacagcacacatccatggaaagatctaccggagaagagggctgctcacatctgagggcaaggacattaagaacaagactgaaattctggccttcctggcagctctgttcctacaaaaaagactgagcattatacattgcccagggcatcagaagggacacagccccgaggcacggggaaatcggctaactgacatctcagcgcgtgaggccgccatgggcacccaagttctgtccttaaaagaccaagatcaacccacgtctccacagccggaacagaccagttggctctacaccacggaggacacaaagctcctacagaaaatgggggccgtttggtacccacaactaaaacggtgggtctacacagggaaaacagttatgcctacgaagatgacctttgaattaatctcctacctacataaattaacacacctgggactcaagaagatgaagaccctcttaagacaagaagagattgacacctacctcctgggacgagatcaggccttgcgggaggtgactgaaagctgcagggcctgtgctcaggtaaacccaggaaaagctaaaattggacaaggagtccgtccccgaggacattggcctggtacccactgggaaattgacttcactgaaatcaagcctggtatgttcggacacaaatacctcttagtgttcatagataccttctccggatggatagaggctttccccacaaaacatgaaatggccaaggtggtgaccaagaagctcctcgaagaaatcttccccagcacatcttcaggccctacaaatcgtgcagagagacatctggaaacctctagccgcggcctaccaagacaggcttgaacaaccgatggtgccgcacccgttccagatcagagacactgtgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]