2024-05-06 08:07:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_173353 590 bp RNA linear ROD 07-OCT-2023 DEFINITION Rattus norvegicus reproductive homeobox like (Rhoxl), non-coding RNA. ACCESSION NR_173353 XM_017602127 VERSION NR_173353.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 590) AUTHORS Gaudet P, Livstone MS, Lewis SE and Thomas PD. TITLE Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium JOURNAL Brief Bioinform 12 (5), 449-462 (2011) PUBMED 21873635 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000455.1. On Oct 25, 2021 this sequence version replaced XM_017602127.2. ##Evidence-Data-START## Transcript exon combination :: FQ221578.1, BF282295.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760383, SAMEA5760389 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-203 JACYVU010000455.1 1400878-1401080 c 204-402 JACYVU010000455.1 1400097-1400295 c 403-590 JACYVU010000455.1 1399649-1399836 c FEATURES Location/Qualifiers source 1..590 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="X" /map="Xq35" gene 1..590 /gene="Rhoxl" /gene_synonym="RGD1560927" /note="reproductive homeobox like" /db_xref="GeneID:501507" /db_xref="RGD:1560927" misc_RNA 1..590 /gene="Rhoxl" /gene_synonym="RGD1560927" /product="reproductive homeobox like" /db_xref="GeneID:501507" /db_xref="RGD:1560927" exon 1..203 /gene="Rhoxl" /gene_synonym="RGD1560927" /inference="alignment:Splign:2.1.0" exon 204..402 /gene="Rhoxl" /gene_synonym="RGD1560927" /inference="alignment:Splign:2.1.0" exon 403..590 /gene="Rhoxl" /gene_synonym="RGD1560927" /inference="alignment:Splign:2.1.0" ORIGIN
ctcaaagcttggagcaaaacagttggcggcagcgcagcgcgaggacagtccagtcgccatctcgcagagcagaccgcctgagagagttccaagcgcctaaagtttcaagaagaccttcgaaatggatcaagcccgcaagttcgagaaccaggacacccgctatcagagcctgggaactgatgcttccttggaaggagctaaaggaatgcccggagccaagaatgatgcgggaatcaaaggccacggtgaccagaaccagccagccctgcaagctgcaggcaggatccagcatttgccgggtgattctgatatcagcatgatctgcaatgccttcagcgggctgcagcttcaagagctggatcgagtcttccaacgcactcagttccccaacgtgtttatgagaaaggaacctggagtaccagcaactgctgaatcccaagctcagtccgttgagcgcagtggaccagaagaaatgtccaagaagccattctaaaacatgcaagaagacatttcacttttccccttgttatttggctactggcccaatgtttgtgaaatttaataaaatttttgaggaattggaaatctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]