2024-05-18 20:49:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_128704 85 bp RNA linear ROD 04-DEC-2021 DEFINITION Rattus norvegicus microRNA 1b (Mir1b), microRNA. ACCESSION NR_128704 VERSION NR_128704.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 85) AUTHORS Li X, Yuan L, Wang J, Zhang Z, Fu S, Wang S and Li X. TITLE MiR-1b up-regulation inhibits rat neuron proliferation and regeneration yet promotes apoptosis via targeting KLF7 JOURNAL Folia Neuropathol 59 (1), 67-80 (2021) PUBMED 33969678 REMARK GeneRIF: MiR-1b up-regulation inhibits rat neuron proliferation and regeneration yet promotes apoptosis via targeting KLF7. REFERENCE 2 (bases 1 to 85) AUTHORS McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ, Simpson DA and Collins A. TITLE Distinctive profile of IsomiR expression and novel microRNAs in rat heart left ventricle JOURNAL PLoS One 8 (6), e65809 (2013) PUBMED 23799049 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 85) AUTHORS Garcia-Lopez J, Hourcade Jde D and Del Mazo J. TITLE Reprogramming of microRNAs by adenosine-to-inosine editing and the selective elimination of edited microRNA precursors in mouse oocytes and preimplantation embryos JOURNAL Nucleic Acids Res 41 (10), 5483-5493 (2013) PUBMED 23571754 REFERENCE 4 (bases 1 to 85) AUTHORS Polikepahad S and Corry DB. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 5 (bases 1 to 85) AUTHORS Qian L, Wythe JD, Liu J, Cartry J, Vogler G, Mohapatra B, Otway RT, Huang Y, King IN, Maillet M, Zheng Y, Crawley T, Taghli-Lamallem O, Semsarian C, Dunwoodie S, Winlaw D, Harvey RP, Fatkin D, Towbin JA, Molkentin JD, Srivastava D, Ocorr K, Bruneau BG and Bodmer R. TITLE Tinman/Nkx2-5 acts via miR-1 and upstream of Cdc42 to regulate heart function across species JOURNAL J Cell Biol 193 (7), 1181-1196 (2011) PUBMED 21690310 REFERENCE 6 (bases 1 to 85) AUTHORS Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S and Russo T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 7 (bases 1 to 85) AUTHORS Ikeda S, He A, Kong SW, Lu J, Bejar R, Bodyak N, Lee KH, Ma Q, Kang PM, Golub TR and Pu WT. TITLE MicroRNA-1 negatively regulates expression of the hypertrophy-associated calmodulin and Mef2a genes JOURNAL Mol Cell Biol 29 (8), 2193-2204 (2009) PUBMED 19188439 REFERENCE 8 (bases 1 to 85) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 9 (bases 1 to 85) AUTHORS Mansfield JH, Harfe BD, Nissen R, Obenauer J, Srineel J, Chaudhuri A, Farzan-Kashani R, Zuker M, Pasquinelli AE, Ruvkun G, Sharp PA, Tabin CJ and McManus MT. TITLE MicroRNA-responsive 'sensor' transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression JOURNAL Nat Genet 36 (10), 1079-1083 (2004) PUBMED 15361871 REMARK Erratum:[Nat Genet. 2004 Nov;36(11):1238] REFERENCE 10 (bases 1 to 85) AUTHORS Jakoby,W.B., Ketterer,B. and Mannervik,B. TITLE Glutathione transferases: nomenclature JOURNAL Biochem Pharmacol 33 (16), 2539-2540 (1984) PUBMED 6466370 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JACYVU010000123.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-85 JACYVU010000123.1 3084850-3084934 FEATURES Location/Qualifiers source 1..85 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3q43" gene 1..85 /gene="Mir1b" /gene_synonym="rno-mir-1b" /note="microRNA 1b" /db_xref="GeneID:104796289" /db_xref="miRBase:MI0031785" /db_xref="RGD:9685084" precursor_RNA 1..85 /gene="Mir1b" /gene_synonym="rno-mir-1b" /product="microRNA 1b" /db_xref="GeneID:104796289" /db_xref="miRBase:MI0031785" /db_xref="RGD:9685084" exon 1..85 /gene="Mir1b" /gene_synonym="rno-mir-1b" /inference="alignment:Splign:2.1.0" ncRNA 52..73 /ncRNA_class="miRNA" /gene="Mir1b" /gene_synonym="rno-mir-1b" /product="rno-miR-1b" /db_xref="miRBase:MIMAT0037263" /db_xref="GeneID:104796289" /db_xref="miRBase:MI0031785" /db_xref="RGD:9685084" ORIGIN
cctgcttgggacacatacttctttatatgcccatatggacctgctaagctatggaatgtaaagaagtatgtatttcaggctagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]