LOCUS       NM_153627                689 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus PROP paired-like homeobox 1 (Prop1), mRNA.
ACCESSION   NM_153627 XM_001072330 XM_039085313
VERSION     NM_153627.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 689)
  AUTHORS   Yoshida S, Fujiwara K, Nishihara H, Kato T, Yashiro T and Kato Y.
  TITLE     Retinoic acid signalling is a candidate regulator of the expression
            of pituitary-specific transcription factor Prop1 in the developing
            rodent pituitary
  JOURNAL   J Neuroendocrinol 30 (3), e12570 (2018)
   PUBMED   29356182
  REMARK    GeneRIF: Ex vivo organ culture using Rathke's pouch and an in vitro
            reporter assay demonstrated that retinoic acid signalling increases
            the expression level of Prop1 via RARalpha
REFERENCE   2  (bases 1 to 689)
  AUTHORS   Nishihara H, Yoshida S, Kanno N, Nishimura N, Ueharu H, Ohgane J,
            Kato T and Kato Y.
  TITLE     Involvement of DNA methylation in regulating rat Prop1 gene
            expression during pituitary organogenesis
  JOURNAL   J Reprod Dev 63 (1), 37-44 (2017)
   PUBMED   27773885
  REMARK    GeneRIF: Prop1 is under regulation by CpG methylation during the
            early period of pituitary primordium development around E13.5
REFERENCE   3  (bases 1 to 689)
  AUTHORS   Nishimura N, Ueharu H, Nishihara H, Shibuya S, Yoshida S, Higuchi
            M, Kanno N, Horiguchi K, Kato T and Kato Y.
  TITLE     Search for regulatory factors of the pituitary-specific
            transcription factor PROP1 gene
  JOURNAL   J Reprod Dev 62 (1), 93-102 (2016)
   PUBMED   26640231
  REMARK    GeneRIF: SOX2 is a regulatory factor of Prop1 expression
REFERENCE   4  (bases 1 to 689)
  AUTHORS   Yako H, Kato T, Yoshida S, Higuchi M, Chen M, Kanno N, Ueharu H and
            Kato Y.
  TITLE     Three-dimensional studies of Prop1-expressing cells in the rat
            pituitary just before birth
  JOURNAL   Cell Tissue Res 354 (3), 837-847 (2013)
   PUBMED   24026438
  REMARK    GeneRIF: Five cell types were observed expressing Sox2, Prop1 and
            Prx; these were heterogeneously distributed in the mediolateral and
            dorsoventral axes of the pituitary gland.
REFERENCE   5  (bases 1 to 689)
  AUTHORS   Yoshida S, Kato T, Susa T, Cai LY, Nakayama M and Kato Y.
  TITLE     PROP1 coexists with SOX2 and induces PIT1-commitment cells
  JOURNAL   Biochem Biophys Res Commun 385 (1), 11-15 (2009)
   PUBMED   19442651
  REMARK    GeneRIF: PROP1 is consistently expressed in SOX2-expressing
            stem/progenitor cells in the rat pituitary from embryonic (E) to
            postnatal periods.
REFERENCE   6  (bases 1 to 689)
  AUTHORS   Raetzman LT, Ward R and Camper SA.
  TITLE     Lhx4 and Prop1 are required for cell survival and expansion of the
            pituitary primordia
  JOURNAL   Development 129 (18), 4229-4239 (2002)
   PUBMED   12183375
REFERENCE   7  (bases 1 to 689)
  AUTHORS   Fluck C, Deladoey J, Rutishauser K, Eble A, Marti U, Wu W and
            Mullis PE.
  TITLE     Phenotypic variability in familial combined pituitary hormone
            deficiency caused by a PROP1 gene mutation resulting in the
            substitution of Arg-->Cys at codon 120 (R120C)
  JOURNAL   J Clin Endocrinol Metab 83 (10), 3727-3734 (1998)
   PUBMED   9768691
REFERENCE   8  (bases 1 to 689)
  AUTHORS   Wu W, Cogan JD, Pfaffle RW, Dasen JS, Frisch H, O'Connell SM, Flynn
            SE, Brown MR, Mullis PE, Parks JS, Phillips JA 3rd and Rosenfeld
            MG.
  TITLE     Mutations in PROP1 cause familial combined pituitary hormone
            deficiency
  JOURNAL   Nat Genet 18 (2), 147-149 (1998)
   PUBMED   9462743
REFERENCE   9  (bases 1 to 689)
  AUTHORS   Romero MI and Phelps CJ.
  TITLE     Identification of growth hormone-releasing hormone and somatostatin
            neurons projecting to the median eminence in normal and growth
            hormone-deficient Ames dwarf mice
  JOURNAL   Neuroendocrinology 65 (2), 107-116 (1997)
   PUBMED   9067988
REFERENCE   10 (bases 1 to 689)
  AUTHORS   Cheng,T.C., Beamer,W.G., Phillips,J.A. 3rd, Bartke,A.,
            Mallonee,R.L. and Dowling,C.
  TITLE     Etiology of growth hormone deficiency in little, Ames, and Snell
            dwarf mice
  JOURNAL   Endocrinology 113 (5), 1669-1678 (1983)
   PUBMED   6194978
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000219.1.
            
            On or before Mar 9, 2021 this sequence version replaced
            XM_039085313.1, NM_153627.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB037922.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-112               JACYVU010000219.1  23307637-23307748   c
            113-336             JACYVU010000219.1  23306360-23306583   c
            337-689             JACYVU010000219.1  23305273-23305625   c
FEATURES             Location/Qualifiers
     source          1..689
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q22"
     gene            1..689
                     /gene="Prop1"
                     /note="PROP paired-like homeobox 1"
                     /db_xref="GeneID:266738"
                     /db_xref="RGD:628759"
     exon            1..112
                     /gene="Prop1"
                     /inference="alignment:Splign:2.1.0"
     CDS             4..675
                     /gene="Prop1"
                     /note="prophet of Pit1, paired-like homeodomain
                     transcription factor; paired like homeodomain factor 1"
                     /codon_start=1
                     /product="homeobox protein prophet of Pit-1"
                     /protein_id="NP_705891.1"
                     /db_xref="GeneID:266738"
                     /db_xref="RGD:628759"
                     /translation="

MEAQRRSQQEKQTKGPVCGRSLPESQAASGTLISTVDRSPETSKRLSGTGLGRPKLCPQRGRPHSRRRHRTTFNPAQLGQLESAFGRNQYPDIWVREGLAQDTGLSEARIQVWFQNRRAKQRKQERSLLQPTAHLSPATFSGFLSESSPYPYTYTTPPPPVPCFPHPYNHALPSQPCTGASLTLPAQPEDWYPTLHPTHTGHLACPPPPPMFSLSLETPKSWN"

     misc_feature    order(202..216,220..222,271..273,289..291,328..330,
                     334..339,346..351,355..363,367..372)
                     /gene="Prop1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    208..369
                     /gene="Prop1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(208..210,217..219,337..339,346..351,358..360)
                     /gene="Prop1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            113..336
                     /gene="Prop1"
                     /inference="alignment:Splign:2.1.0"
     exon            337..689
                     /gene="Prop1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gccatggaagctcaaagaaggagccagcaggaaaagcaaacaaagggccctgtctgtggccgatccctgcctgagtcacaggcggcctctgggactctgatctccacagtagacaggagccctgagacttctaagagactctctggtacagggctggggagacccaagctttgcccacagaggggccgtccccactcccggcgtcgccaccgcaccaccttcaacccagcacagctgggacagctggagtcagcctttgggaggaaccagtatcctgacatctgggttcgagaggggcttgcccaagacactggcctcagcgaagccagaatccaggtctggttccagaaccgcagggctaagcaacggaagcaagagcggtcactactccagccaacagcccatctgtctccggccaccttctctggcttcttgtcagagtcctctccttacccctacacctatacaacaccacctccacccgtaccctgcttccctcacccctacaaccacgctctcccctcccagccctgtacgggtgcctcactcactcttcctgcccagcctgaggactggtaccccaccttgcacccaacccacactggtcatctggcctgtcccccacccccacccatgttttccctcagcctggagacaccaaagtcctggaactgagcggtgccgtcacc

//