GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 07:18:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_133514               1714 bp    mRNA    linear   ROD 20-NOV-2023
DEFINITION  Rattus norvegicus matrix metallopeptidase 10 (Mmp10), mRNA.
ACCESSION   NM_133514
VERSION     NM_133514.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1714)
  AUTHORS   Faraj Shaglouf LH, Ranjpour M, Wajid S and Jain SK.
  TITLE     Elevated expression of cellular SYNE1, MMP10, and GTPase1 and their
            regulatory role in hepatocellular carcinoma progression
  JOURNAL   Protoplasma 257 (1), 157-167 (2020)
   PUBMED   31428857
  REMARK    GeneRIF: Elevated expression of cellular SYNE1, MMP10, and GTPase1
            and their regulatory role in hepatocellular carcinoma progression.
REFERENCE   2  (bases 1 to 1714)
  AUTHORS   Takamura Y, Matsumoto T, Tomomatsu T, Matsumura T, Takihara Y and
            Inatani M.
  TITLE     Aldose reductase inhibitor counteracts the enhanced expression of
            matrix metalloproteinase-10 and improves corneal wound healing in
            galactose-fed rats
  JOURNAL   Mol Vis 19, 2477-2486 (2013)
   PUBMED   24339723
  REMARK    GeneRIF: MMP-10 modulates corneal epithelial wound healing.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1714)
  AUTHORS   Thibert KA, Raymond GV, Nascene DR, Miller WP, Tolar J, Orchard PJ
            and Lund TC.
  TITLE     Cerebrospinal fluid matrix metalloproteinases are elevated in
            cerebral adrenoleukodystrophy and correlate with MRI severity and
            neurologic dysfunction
  JOURNAL   PLoS One 7 (11), e50430 (2012)
   PUBMED   23185624
REFERENCE   4  (bases 1 to 1714)
  AUTHORS   Friese RS, Rao F, Khandrika S, Thomas B, Ziegler MG,
            Schmid-Schonbein GW and O'Connor DT.
  TITLE     Matrix metalloproteinases: discrete elevations in essential
            hypertension and hypertensive end-stage renal disease
  JOURNAL   Clin Exp Hypertens 31 (7), 521-533 (2009)
   PUBMED   19886850
REFERENCE   5  (bases 1 to 1714)
  AUTHORS   Nishino K, Yamanouchi K, Naito K and Tojo H.
  TITLE     Matrix metalloproteinases regulate mesonephric cell migration in
            developing XY gonads which correlates with the inhibition of tissue
            inhibitor of metalloproteinase-3 by Sry
  JOURNAL   Dev Growth Differ 44 (1), 35-43 (2002)
   PUBMED   11869290
REFERENCE   6  (bases 1 to 1714)
  AUTHORS   Saghizadeh M, Brown DJ, Castellon R, Chwa M, Huang GH, Ljubimova
            JY, Rosenberg S, Spirin KS, Stolitenko RB, Adachi W, Kinoshita S,
            Murphy G, Windsor LJ, Kenney MC and Ljubimov AV.
  TITLE     Overexpression of matrix metalloproteinase-10 and matrix
            metalloproteinase-3 in human diabetic corneas: a possible mechanism
            of basement membrane and integrin alterations
  JOURNAL   Am J Pathol 158 (2), 723-734 (2001)
   PUBMED   11159210
REFERENCE   7  (bases 1 to 1714)
  AUTHORS   Chan JC, Scanlon M, Zhang HZ, Jia LB, Yu DH, Hung MC, French M and
            Eastman EM.
  TITLE     Molecular cloning and characterization of v-mos-activated
            transformation-associated proteins
  JOURNAL   J Biol Chem 267 (2), 1099-1103 (1992)
   PUBMED   1370458
REFERENCE   8  (bases 1 to 1714)
  AUTHORS   De Vouge MW and Mukherjee BB.
  TITLE     Transformation of normal rat kidney cells by v-K-ras enhances
            expression of transin 2 and an S-100-related calcium-binding
            protein
  JOURNAL   Oncogene 7 (1), 109-119 (1992)
   PUBMED   1741158
REFERENCE   9  (bases 1 to 1714)
  AUTHORS   Breathnach,R., Matrisian,L.M., Gesnel,M.C., Staub,A. and Leroy,P.
  TITLE     Sequences coding for part of oncogene-induced transin are highly
            conserved in a related rat gene
  JOURNAL   Nucleic Acids Res 15 (3), 1139-1151 (1987)
   PUBMED   3547333
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000188.1.
            
            On Nov 24, 2020 this sequence version replaced NM_133514.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X05083.1, M65253.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00132261, SAMD00132265
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-139               JACYVU010000188.1  4689840-4689978
            140-384             JACYVU010000188.1  4690615-4690859
            385-533             JACYVU010000188.1  4690951-4691099
            534-659             JACYVU010000188.1  4691540-4691665
            660-824             JACYVU010000188.1  4692800-4692964
            825-966             JACYVU010000188.1  4693512-4693653
            967-1100            JACYVU010000188.1  4694453-4694586
            1101-1260           JACYVU010000188.1  4695259-4695418
            1261-1364           JACYVU010000188.1  4696091-4696194
            1365-1714           JACYVU010000188.1  4697399-4697748
FEATURES             Location/Qualifiers
     source          1..1714
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q11"
     gene            1..1714
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="matrix metallopeptidase 10"
                     /db_xref="GeneID:117061"
                     /db_xref="RGD:620192"
     exon            1..139
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    5..7
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="upstream in-frame stop codon"
     CDS             35..1465
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /EC_number="3.4.24.22"
                     /note="stromelysin-2; transin-2; matrix
                     metalloproteinase-10; transformation-associated protein
                     34A"
                     /codon_start=1
                     /product="stromelysin-2 precursor"
                     /protein_id="NP_598198.2"
                     /db_xref="GeneID:117061"
                     /db_xref="RGD:620192"
                     /translation="
MEPLAILVLLCFPICSAYPLHGAVRQDHSTMDLAQQYLEKYYNFRKNEKQFFKRKDSSPVVKKIEEMQKFLGLEMTGKLDSNTVEMMHKPRCGVPDVGGFSTFPGSPKWRKNHISYRIVNYTLDLPRESVDSAIERALKVWEEVTPLTFSRISEGEADIMISFAVGEHGDFYPFDGVGQSLAHAYPPGPGFYGDAHFDDDEKWSLGPSGTNLFLVAAHELGHSLGLFHSNNKESLMYPVYRFSTSQANIRLSQDDIEGIQSLYGARPSSDATVVPVPSVSPKPETPVKCDPALSFDAVTMLRGEFLFFKDRHFWRRTQWNPEPEFHLISAFWPSLPSGLDAAYEANNKDRVLIFKGSQFWAVRGNEVQAGYPKRIHTLGFPPTVKKIDAAVFEKEKKKTYFFVGDKYWRFDETRQLMDKGFPRLITDDFPGIEPQVDAVLHAFGFFYFFRGSSQFEFDPNARTVTHTLKSNSWLLC"
     sig_peptide     35..85
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    131..295
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Putative peptidoglycan binding domain; Region:
                     PG_binding_1; pfam01471"
                     /db_xref="CDD:426277"
     misc_feature    302..325
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Cysteine switch. /evidence=ECO:0000250"
     mat_peptide     332..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /product="Stromelysin-2. /id=PRO_0000028769"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1)"
     misc_feature    356..826
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Matrixin; Region: Peptidase_M10; pfam00413"
                     /db_xref="CDD:425668"
     misc_feature    890..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Hemopexin-like repeats.; Hemopexin is a
                     heme-binding protein that transports heme to the liver.
                     Hemopexin-like repeats occur in vitronectin and some
                     matrix metalloproteinases family (matrixins). The HX
                     repeats of some matrixins bind tissue inhibitor of...;
                     Region: HX; cd00094"
                     /db_xref="CDD:238046"
     misc_feature    890..1039
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 1"
     misc_feature    order(920..922,926..928,1052..1054,1058..1060,1196..1198,
                     1202..1204,1343..1345,1349..1351)
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="Metal binding sites [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238046"
     misc_feature    1040..1180
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 2"
     misc_feature    1184..1330
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 3"
     misc_feature    1331..1462
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /note="propagated from UniProtKB/Swiss-Prot (P07152.1);
                     Region: Hemopexin 4"
     exon            140..384
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            385..533
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            534..659
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            660..824
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            825..966
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            967..1100
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1101..1260
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1261..1364
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
     exon            1365..1714
                     /gene="Mmp10"
                     /gene_synonym="SL-2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aagttaggtgctacagaaggtaaaggctgtctctatggagccactggccatcctggtgctgctgtgctttccgatctgctcagcatatcctctgcatggggcagtgagacaagaccactcaaccatggatcttgctcagcaatacctagaaaaatactacaactttagaaaaaatgagaaacaatttttcaaaagaaaggacagtagtcctgttgtcaaaaaaattgaagaaatgcagaagttccttgggctggagatgacagggaagctggactcgaacactgtggagatgatgcacaagccccggtgtggtgttcccgacgtcggtggcttcagtacctttccaggttcacccaaatggaggaaaaaccacatctcctacaggattgtgaattatacactggatttaccaagagagagtgtggattctgccattgagagagctttgaaggtctgggaggaggtgaccccactcacattctccaggatctctgaaggagaggctgacataatgatctcctttgcagttggagaacatggagacttttacccttttgatggagtgggacagagcttggctcatgcctacccacctggccctggattttatggagatgctcacttcgatgatgatgagaaatggtcactgggaccctcagggaccaatttattcctggttgctgcgcatgaacttggtcactccctgggtctctttcactcaaacaacaaagaatctctgatgtacccagtctacaggttctccacgagccaagccaacattcgcctttctcaggatgatatagagggcattcaatccctgtatggagcccgcccctcctctgatgccacagtggttcctgtgccctctgtctctccaaaacctgagaccccagtcaaatgtgatcctgctttgtcctttgatgcagtcaccatgctgagaggggaattcctattctttaaagacaggcacttctggcgtagaacccagtggaatcccgagcctgaattccatttgatttcagcattttggccctctcttccttcaggcttagatgctgcctatgaggcaaataacaaggacagagttctgatttttaaaggaagtcagttctgggcagtccgaggaaatgaagtccaagcaggttacccaaagaggatccacactcttggctttcctcccaccgtgaagaagattgatgcagctgtttttgaaaaggagaagaagaagacgtatttctttgtaggtgacaaatactggagatttgatgagacaagacagcttatggataaaggcttcccgagactgataacagatgacttcccaggaattgagccacaagttgatgctgtgttacatgcatttgggtttttttatttcttccgtggatcatcacagttcgagtttgaccccaatgccaggacggtgacacacacactgaagagcaacagctggctgttgtgctgattatcatgatgacaagacatatacaacactgtaaaatagtatttctcgcctaatttattatgtgtcataatgatgaattgttcctgcatgtgctgtggctcgagatgagcccagcagatagatgtctttcttaatgaaccacagagcatcacctgagcacagaagtgaaagcttctcggtacactaggtgagaggatgcatccccatgggtactttattgtttaataaagaactttatttttgaaccat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]