LOCUS       NM_053708               1538 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus gastrulation brain homeobox 2 (Gbx2), mRNA.
ACCESSION   NM_053708 XM_001066354 XM_346072
VERSION     NM_053708.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1538)
  AUTHORS   Roeseler DA, Sachdev S, Buckley DM, Joshi T, Wu DK, Xu D, Hannink M
            and Waters ST.
  TITLE     Elongation factor 1 alpha1 and genes associated with Usher
            syndromes are downstream targets of GBX2
  JOURNAL   PLoS One 7 (11), e47366 (2012)
   PUBMED   23144817
REFERENCE   2  (bases 1 to 1538)
  AUTHORS   Chen L, Chatterjee M and Li JY.
  TITLE     The mouse homeobox gene Gbx2 is required for the development of
            cholinergic interneurons in the striatum
  JOURNAL   J Neurosci 30 (44), 14824-14834 (2010)
   PUBMED   21048141
REFERENCE   3  (bases 1 to 1538)
  AUTHORS   Calmont A, Ivins S, Van Bueren KL, Papangeli I, Kyriakopoulou V,
            Andrews WD, Martin JF, Moon AM, Illingworth EA, Basson MA and
            Scambler PJ.
  TITLE     Tbx1 controls cardiac neural crest cell migration during arch
            artery development by regulating Gbx2 expression in the pharyngeal
            ectoderm
  JOURNAL   Development 136 (18), 3173-3183 (2009)
   PUBMED   19700621
REFERENCE   4  (bases 1 to 1538)
  AUTHORS   Chen L, Guo Q and Li JY.
  TITLE     Transcription factor Gbx2 acts cell-nonautonomously to regulate the
            formation of lineage-restriction boundaries of the thalamus
  JOURNAL   Development 136 (8), 1317-1326 (2009)
   PUBMED   19279136
REFERENCE   5  (bases 1 to 1538)
  AUTHORS   Waters ST and Lewandoski M.
  TITLE     A threshold requirement for Gbx2 levels in hindbrain development
  JOURNAL   Development 133 (10), 1991-2000 (2006)
   PUBMED   16651541
REFERENCE   6  (bases 1 to 1538)
  AUTHORS   Hevner RF, Miyashita-Lin E and Rubenstein JL.
  TITLE     Cortical and thalamic axon pathfinding defects in Tbr1, Gbx2, and
            Pax6 mutant mice: evidence that cortical and thalamic axons
            interact and guide each other
  JOURNAL   J Comp Neurol 447 (1), 8-17 (2002)
   PUBMED   11967891
REFERENCE   7  (bases 1 to 1538)
  AUTHORS   Ni Z, Lou W, Leman ES and Gao AC.
  TITLE     Inhibition of constitutively activated Stat3 signaling pathway
            suppresses growth of prostate cancer cells
  JOURNAL   Cancer Res 60 (5), 1225-1228 (2000)
   PUBMED   10728680
REFERENCE   8  (bases 1 to 1538)
  AUTHORS   Mason I, Chambers D, Shamim H, Walshe J and Irving C.
  TITLE     Regulation and function of FGF8 in patterning of midbrain and
            anterior hindbrain
  JOURNAL   Biochem Cell Biol 78 (5), 577-584 (2000)
   PUBMED   11103948
REFERENCE   9  (bases 1 to 1538)
  AUTHORS   Kowenz-Leutz E, Herr P, Niss K and Leutz A.
  TITLE     The homeobox gene GBX2, a target of the myb oncogene, mediates
            autocrine growth and monocyte differentiation
  JOURNAL   Cell 91 (2), 185-195 (1997)
   PUBMED   9346236
REFERENCE   10 (bases 1 to 1538)
  AUTHORS   Lin X, Swaroop A, Vaccarino FM, Murtha MT, Haas M, Ji X, Ruddle FH
            and Leckman JF.
  TITLE     Characterization and sequence analysis of the human
            homeobox-containing gene GBX2
  JOURNAL   Genomics 31 (3), 335-342 (1996)
   PUBMED   8838315
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000215.1.
            
            On Feb 10, 2021 this sequence version replaced NM_053708.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments and homology data.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760383,
                              SAMEA5760393 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-561               JACYVU010000215.1  23581343-23581903   c
            562-1538            JACYVU010000215.1  23579324-23580300   c
FEATURES             Location/Qualifiers
     source          1..1538
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="9"
                     /map="9q36"
     gene            1..1538
                     /gene="Gbx2"
                     /note="gastrulation brain homeobox 2"
                     /db_xref="GeneID:114500"
                     /db_xref="RGD:621866"
     exon            1..561
                     /gene="Gbx2"
                     /inference="alignment:Splign:2.1.0"
     CDS             39..1085
                     /gene="Gbx2"
                     /codon_start=1
                     /product="homeobox protein GBX-2"
                     /protein_id="NP_446160.1"
                     /db_xref="GeneID:114500"
                     /db_xref="RGD:621866"
                     /translation="

MSAAFPPSLMMMQRPLGSSTAFSIDSLIGSPPQPSPGHFVYTGYPMFMPYRPVVLPPPPPPPPALPQAALQPALPPAHPHHQIPSLPTGFCSSLAQGMALTSTLMATLPGGFSASPQHQEAAAARKFAPQPLPGGGNFDKSEALQADTEDGKAFLAKEGSLLAFSAAEAVQASLVGAVRGQGKDESKVEDDPKGKEESFSLESDVDYSSDDNLPGQTAHKEEDPGHALEETPQSGGAAGSTTSTGKNRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRVKAGNANSKTGEPSRNPKIVVPIPVHVSRFAIRSQHQQLEQARP"

     misc_feature    order(780..794,798..800,849..851,867..869,906..908,
                     912..917,924..929,933..941,945..950)
                     /gene="Gbx2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    786..947
                     /gene="Gbx2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(786..788,795..797,915..917,924..929,936..938)
                     /gene="Gbx2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            562..1538
                     /gene="Gbx2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gacttttcgtctctccctggcttctcccgaacgcgtctatgagcgcagcgttcccgccgtcgctgatgatgatgcagcgcccgctggggagtagtaccgccttcagcatagactcgctgatcggcagcccgccgcagcccagtcccggccatttcgtctacaccggctaccccatgtttatgccctaccggccggtggtgctgccgccaccgccgccgccgcctcccgcgctgccccaggcagcgctacagcccgcgctgccgcccgcgcaccctcaccaccagatccccagcttgcccaccggcttctgctccagcctggcgcagggcatggcgctcacctccactctcatggccacgctgcccggcggcttctctgcgtcgccccagcaccaagaggcggccgccgcccgcaagttcgctccgcagccgctgcctggaggcggcaacttcgacaaatccgaggcgctccaagccgatacggaggacggcaaagccttcttggccaaggagggctcgctgctcgccttctctgcggccgaagcggtgcaagcgtcgctcgtcggggctgtccgagggcaagggaaagacgagtcaaaggtggaagatgacccgaagggcaaggaggagagcttctctctggagagcgatgtggattacagctcagatgacaatttgcctggccagactgctcataaggaagaagaccccggccacgcactggaggagaccccgcagagcggcggtgcggcaggtagcaccacgtccacaggcaagaaccggcggcggcggactgcctttaccagcgagcagctgctggagctggagaaggaattccactgcaaaaagtacctctccctgaccgagcgctcacagatcgcccatgccctcaaactcagcgaggtgcaagtaaaaatctggttccagaaccgccgggccaagtggaaacgtgtcaaggcaggcaacgccaattccaagacgggggagccctctcggaaccccaagatcgtagtccccatccctgtccatgtcagcaggttcgctattcgaagtcaacaccagcagctggagcaggcccgaccctgagggcccagccagggtggacaccaccgtggagaggccctaacacttgagggaacccgtgtcagactccactctttaaagcagaactcagaggcacctcccagatgtggacatcccaaacaaaatgagagtatattcattagaccagcttaaagggggctacagccacaccagaagatacactaaatatttattatacaaccctactttgtacatagatctctatatagactggatctcagctgcagtgtttggaaagggataggatcaaacctctccacttacactttccagatgaaacaaaaccaccactgtactgtctccttcagcgaccacttcccatactttcccaaaggtaaacgggagacccaagaacactgcggtttaacctcattttcttgtttgtttctattctggctttttgagttgagtgcagagcagtcggttttttggttt

//