ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-10-14 06:35:39, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_053524 2176 bp mRNA linear ROD 23-JUN-2025
DEFINITION Rattus norvegicus NADPH oxidase 4 (Nox4), mRNA.
ACCESSION NM_053524
VERSION NM_053524.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2176)
AUTHORS Li,S., Lyu,Q., Shi,Q., Bai,Y., Ren,X. and Ma,J.
TITLE Intermittent short-duration reoxygenation relieves high-altitude
pulmonary hypertension via NOX4/H2O2/PPAR-gamma axis
JOURNAL Clin Sci (Lond) 138 (3), 103-115 (2024)
PUBMED 38237016
REMARK GeneRIF: Intermittent short-duration reoxygenation relieves
high-altitude pulmonary hypertension via NOX4/H2O2/PPAR-gamma axis.
REFERENCE 2 (bases 1 to 2176)
AUTHORS Naser,N., Lonj,C.K., Rikard-Bell,M., Sandow,S.L. and Murphy,T.V.
TITLE Advanced glycated end-products inhibit dilation through
constitutive endothelial RAGE and Nox1/4 in rat isolated skeletal
muscle arteries
JOURNAL Microcirculation 31 (1), e12837 (2024)
PUBMED 37985248
REMARK GeneRIF: Advanced glycated end-products inhibit dilation through
constitutive endothelial RAGE and Nox1/4 in rat isolated skeletal
muscle arteries.
REFERENCE 3 (bases 1 to 2176)
AUTHORS Matsunaga,S., Kohda,A., Kamakura,S., Hayase,J., Miyano,K.,
Shiose,A. and Sumimoto,H.
TITLE Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in
cardiomyocytes via suppressing autophagy-related lysosomal
degradation
JOURNAL Genes Cells 29 (1), 63-72 (2024)
PUBMED 37985134
REMARK GeneRIF: Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in
cardiomyocytes via suppressing autophagy-related lysosomal
degradation.
REFERENCE 4 (bases 1 to 2176)
AUTHORS Zhang,Y., Shan,M., Ding,X., Sun,H., Qiu,F. and Shi,L.
TITLE Maternal exercise represses Nox4 via SIRT1 to prevent vascular
oxidative stress and endothelial dysfunction in SHR offspring
JOURNAL Front Endocrinol (Lausanne) 14, 1219194 (2023)
PUBMED 37501791
REMARK GeneRIF: Maternal exercise represses Nox4 via SIRT1 to prevent
vascular oxidative stress and endothelial dysfunction in SHR
offspring.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 2176)
AUTHORS Sun,Z.H., Liu,F., Kong,L.L., Ji,P.M., Huang,L., Zhou,H.M., Sun,R.,
Luo,J. and Li,W.Z.
TITLE Interruption of TRPC6-NFATC1 signaling inhibits NADPH oxidase 4 and
VSMCs phenotypic switch in intracranial aneurysm
JOURNAL Biomed Pharmacother 161, 114480 (2023)
PUBMED 37002575
REMARK GeneRIF: Interruption of TRPC6-NFATC1 signaling inhibits NADPH
oxidase 4 and VSMCs phenotypic switch in intracranial aneurysm.
REFERENCE 6 (bases 1 to 2176)
AUTHORS Gorin,Y., Ricono,J.M., Kim,N.H., Bhandari,B., Choudhury,G.G. and
Abboud,H.E.
TITLE Nox4 mediates angiotensin II-induced activation of Akt/protein
kinase B in mesangial cells
JOURNAL Am J Physiol Renal Physiol 285 (2), F219-F229 (2003)
PUBMED 12842860
REMARK GeneRIF: Nox4-based NAD(P)H oxidase and generation of reactive
oxygen species mediate the effect of ANG II on Akt/PKB activation
and protein synthesis in glomerular mesangial cells
REFERENCE 7 (bases 1 to 2176)
AUTHORS Lassegue,B., Sorescu,D., Szocs,K., Yin,Q., Akers,M., Zhang,Y.,
Grant,S.L., Lambeth,J.D. and Griendling,K.K.
TITLE Novel gp91(phox) homologues in vascular smooth muscle cells : nox1
mediates angiotensin II-induced superoxide formation and
redox-sensitive signaling pathways
JOURNAL Circ Res 88 (9), 888-894 (2001)
PUBMED 11348997
REFERENCE 8 (bases 1 to 2176)
AUTHORS Yang,S., Madyastha,P., Bingel,S., Ries,W. and Key,L.
TITLE A new superoxide-generating oxidase in murine osteoclasts
JOURNAL J Biol Chem 276 (8), 5452-5458 (2001)
PUBMED 11098048
REFERENCE 9 (bases 1 to 2176)
AUTHORS Shiose,A., Kuroda,J., Tsuruya,K., Hirai,M., Hirakata,H., Naito,S.,
Hattori,M., Sakaki,Y. and Sumimoto,H.
TITLE A novel superoxide-producing NAD(P)H oxidase in kidney
JOURNAL J Biol Chem 276 (2), 1417-1423 (2001)
PUBMED 11032835
REFERENCE 10 (bases 1 to 2176)
AUTHORS Geiszt,M., Kopp,J.B., Varnai,P. and Leto,T.L.
TITLE Identification of renox, an NAD(P)H oxidase in kidney
JOURNAL Proc Natl Acad Sci U S A 97 (14), 8010-8014 (2000)
PUBMED 10869423
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AY027527.1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY027527.1, AB044086.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA5760400, SAMEA5760476
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..2176
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="Sprague-Dawley"
/db_xref="taxon:10116"
/chromosome="1"
/map="1q32"
gene 1..2176
/gene="Nox4"
/note="NADPH oxidase 4"
/db_xref="GeneID:85431"
/db_xref="RGD:620600"
exon 1..106
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
CDS 50..1786
/gene="Nox4"
/EC_number="1.6.3.1"
/note="kox-1; kidney superoxide-producing NADPH oxidase;
kidney oxidase-1"
/codon_start=1
/product="NADPH oxidase 4"
/protein_id="NP_445976.1"
/db_xref="GeneID:85431"
/db_xref="RGD:620600"
/translation="
MALSWRSWLANEGVKHLCLLVWLSLNVLLFWKTFLLYNQGPEYYYIHQMLGLGLCLSRASASVLNLNCSLILLPMCRTVLAYLRGSQKVPSRRTRRLLDKSKTLHITCGITICIFSGVHVAAHLVNALNFSVNYSEHFLALNAARYQNEDPRKLLFTTVPGLTGVCMVVVLFLMVTASTYAIRVSNYDIFWYTHNLFFVFYMLLLLHVSGGLLKYQTNLDTHPPGCISLNRTPSQNMSIADYVSEHFHGSLPGGFSKLEDHYQKTLVKICLEEPKFQAHFPQTWIWISGPLCLYCAERLYRCIRSNKPVTIISVINHPSDVMELRMIKENFKARPGQYIILHCPSVSALENHPFTLTMCPTETKATFGVHFKVVGDWTERFRDLLLPPSSQDSEILPFIQSRNYPKLYIDGPFGSPFEESLNYEVSLCVAGGIGVTPFASILNTLLDDWKPYKLRRLYFIWVCRDIQSFQWFADLLYVLHNKFWQENRPDFVNIQLYLSQTDGIQKIIGEKYHTLNSRLFIGRPRWKLLFDEIAKCNRGKTVGVFCCGPSSISKTLHNLSNRNNSYGTKFEYNKESFS"
misc_feature 98..160
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 236..298
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 254..664
/gene="Nox4"
/note="Ferric reductase like transmembrane component;
Region: Ferric_reduct; pfam01794"
/db_xref="CDD:426438"
misc_feature 362..424
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 446..448
/gene="Nox4"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q924V1.2); glycosylation site"
misc_feature 512..574
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 614..676
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 701..868
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
Region: E-loop, essential for H2O2 generating catalytic
activity. /evidence=ECO:0000250|UniProtKB:Q9NPH5"
misc_feature 791..1774
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
Region: Mediates interaction with TLR4.
/evidence=ECO:0000250|UniProtKB:Q9NPH5"
misc_feature 980..1780
/gene="Nox4"
/note="NADPH oxidase (NOX) catalyzes the generation of
reactive oxygen species (ROS) such as superoxide and
hydrogen peroxide. ROS were originally identified as
bactericidal agents in phagocytes, but are now also
implicated in cell signaling and metabolism. NOX...;
Region: NOX_Duox_like_FAD_NADP; cd06186"
/db_xref="CDD:99783"
misc_feature order(1061..1063,1103..1114,1157..1165,1172..1183,
1346..1348)
/gene="Nox4"
/note="FAD binding pocket [chemical binding]; other site"
/db_xref="CDD:99783"
misc_feature order(1103..1105,1109..1114)
/gene="Nox4"
/note="FAD binding motif [chemical binding]; other site"
/db_xref="CDD:99783"
misc_feature 1322..1384
/gene="Nox4"
/note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
transmembrane region"
misc_feature 1331..1363
/gene="Nox4"
/note="NAD pyrophosphate binding region [chemical
binding]; other site"
/db_xref="CDD:99783"
misc_feature order(1331..1333,1343..1354,1358..1360)
/gene="Nox4"
/note="beta-alpha-beta stucture motif; other site"
/db_xref="CDD:99783"
misc_feature order(1346..1351,1433..1441,1691..1696)
/gene="Nox4"
/note="NAD binding pocket [chemical binding]; other site"
/db_xref="CDD:99783"
misc_feature order(1427..1432,1439..1441)
/gene="Nox4"
/note="NADP ribose binding motif [chemical binding]; other
site"
/db_xref="CDD:99783"
exon 107..202
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 203..313
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 314..398
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 399..496
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 497..524
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 525..597
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 598..678
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 679..895
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 896..1060
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1061..1123
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1124..1184
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1185..1266
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1267..1386
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1387..1495
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1496..1564
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1565..1665
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
exon 1666..2176
/gene="Nox4"
/inference="alignment:Splign:2.1.0"
ORIGIN
ctttccgtcccaagcaccgagcggagcgcagcacccccgcgccggcggtatggcgctgtcctggaggagctggctggccaacgaaggggttaaacacctctgtctgcttgtttggctgtccctaaatgtcctgcttttctggaaaaccttcctgctgtacaaccaagggccagaatactactacatccaccagatgttgggcctaggattgtgtttgagcagagcttctgcatctgtcctgaacctcaactgcagcctgatccttttacccatgtgccgcacagtcctggcttaccttcgcggatcacagaaggtccctagcaggagaacaagaagattgttggacaaaagcaagactctacatatcacctgtggcataactatttgtattttctcaggtgtgcatgtagctgcccacttggtgaacgccctgaacttctcagtgaactatagtgaacatttccttgcactgaatgcagcaagataccagaatgaggatcccagaaagcttctcttcacaactgttccgggcctgacaggtgtctgcatggtggtggtattgttcctcatggttacagcttctacctatgcaataagagtttctaattatgatatcttctggtatactcacaacctcttctttgtcttctacatgctgctgctgctgcatgtttcgggtggcttgttgaagtatcaaaccaatttagacactcaccctcctggctgtatcagtcttaaccggaccccatctcagaatatgtccatagcagactacgtctcagaacattttcatggatctttgcctggagggttttcaaaattagaagatcattaccagaaaacactggtgaagatttgcctggaagaacccaagttccaagctcatttcccacagacctggatttggatttctggacctttgtgcctatactgtgctgagagactttaccgatgcatccggagcaacaaacctgtcaccattatctcagtaatcaatcatccctcagatgtcatggaactccgtatgatcaaagaaaactttaaagcaagacctggccagtatattattctacattgtcccagtgtatcagcattagaaaaccacccatttactctcacaatgtgtcctactgaaaccaaagcaacatttggtgtccactttaaagtagtaggagactggacagaaagattccgagatttactactgcctccatcaagccaagattctgagattctgcccttcattcaatctagaaactaccccaagttatacattgatggcccatttggaagtccatttgaggagtcactgaactatgaagttagtctgtgtgtggctggaggcattggggtcactccgtttgcatcgatactaaacactctactggatgactggaaaccatacaagctaagaagactgtattttatctgggtctgcagagacatccaatcattccagtggtttgcagacttgctctatgtgctgcataacaagttttggcaagaaaacagacctgactttgtgaacatccagctgtacctcagtcaaacagatgggatacagaagataattggagaaaaataccacacattgaattctagactttttattgggcgtcctcggtggaagcttttatttgatgaaatagcaaaatgtaacagagggaaaacagttggagttttctgctgtggacccagttctatttccaagactcttcataatttgagtaaccggaacaactcatatgggacaaaatttgaatacaataaagaatctttcagctaaaaccttaggagactactgggactctaaagaaggaacaagtgcaatttctaagacttagagactcggctgaatcagacagctatgctatgccaaagaatatcaaagttttgctatttatgattatttaaaatgagaattcaaaaagtgtggcaaaaatgacatggttaatctgcaagccaaaggggccctgaagaatatttgatgtggtgattcacatattgatgggcaaattaaaagaatgctgttagatgcacactgttgatttttatgggaaattcaagaactctctaatgaggagctgaactcactcactctgaagctgatagccacagccctctttaaattgttttcagtcgaacaggttcaaagattgaacaaaattaaaaattc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]