GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-14 06:35:39, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_053524               2176 bp    mRNA    linear   ROD 23-JUN-2025
DEFINITION  Rattus norvegicus NADPH oxidase 4 (Nox4), mRNA.
ACCESSION   NM_053524
VERSION     NM_053524.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2176)
  AUTHORS   Li,S., Lyu,Q., Shi,Q., Bai,Y., Ren,X. and Ma,J.
  TITLE     Intermittent short-duration reoxygenation relieves high-altitude
            pulmonary hypertension via NOX4/H2O2/PPAR-gamma axis
  JOURNAL   Clin Sci (Lond) 138 (3), 103-115 (2024)
   PUBMED   38237016
  REMARK    GeneRIF: Intermittent short-duration reoxygenation relieves
            high-altitude pulmonary hypertension via NOX4/H2O2/PPAR-gamma axis.
REFERENCE   2  (bases 1 to 2176)
  AUTHORS   Naser,N., Lonj,C.K., Rikard-Bell,M., Sandow,S.L. and Murphy,T.V.
  TITLE     Advanced glycated end-products inhibit dilation through
            constitutive endothelial RAGE and Nox1/4 in rat isolated skeletal
            muscle arteries
  JOURNAL   Microcirculation 31 (1), e12837 (2024)
   PUBMED   37985248
  REMARK    GeneRIF: Advanced glycated end-products inhibit dilation through
            constitutive endothelial RAGE and Nox1/4 in rat isolated skeletal
            muscle arteries.
REFERENCE   3  (bases 1 to 2176)
  AUTHORS   Matsunaga,S., Kohda,A., Kamakura,S., Hayase,J., Miyano,K.,
            Shiose,A. and Sumimoto,H.
  TITLE     Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in
            cardiomyocytes via suppressing autophagy-related lysosomal
            degradation
  JOURNAL   Genes Cells 29 (1), 63-72 (2024)
   PUBMED   37985134
  REMARK    GeneRIF: Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in
            cardiomyocytes via suppressing autophagy-related lysosomal
            degradation.
REFERENCE   4  (bases 1 to 2176)
  AUTHORS   Zhang,Y., Shan,M., Ding,X., Sun,H., Qiu,F. and Shi,L.
  TITLE     Maternal exercise represses Nox4 via SIRT1 to prevent vascular
            oxidative stress and endothelial dysfunction in SHR offspring
  JOURNAL   Front Endocrinol (Lausanne) 14, 1219194 (2023)
   PUBMED   37501791
  REMARK    GeneRIF: Maternal exercise represses Nox4 via SIRT1 to prevent
            vascular oxidative stress and endothelial dysfunction in SHR
            offspring.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2176)
  AUTHORS   Sun,Z.H., Liu,F., Kong,L.L., Ji,P.M., Huang,L., Zhou,H.M., Sun,R.,
            Luo,J. and Li,W.Z.
  TITLE     Interruption of TRPC6-NFATC1 signaling inhibits NADPH oxidase 4 and
            VSMCs phenotypic switch in intracranial aneurysm
  JOURNAL   Biomed Pharmacother 161, 114480 (2023)
   PUBMED   37002575
  REMARK    GeneRIF: Interruption of TRPC6-NFATC1 signaling inhibits NADPH
            oxidase 4 and VSMCs phenotypic switch in intracranial aneurysm.
REFERENCE   6  (bases 1 to 2176)
  AUTHORS   Gorin,Y., Ricono,J.M., Kim,N.H., Bhandari,B., Choudhury,G.G. and
            Abboud,H.E.
  TITLE     Nox4 mediates angiotensin II-induced activation of Akt/protein
            kinase B in mesangial cells
  JOURNAL   Am J Physiol Renal Physiol 285 (2), F219-F229 (2003)
   PUBMED   12842860
  REMARK    GeneRIF: Nox4-based NAD(P)H oxidase and generation of reactive
            oxygen species mediate the effect of ANG II on Akt/PKB activation
            and protein synthesis in glomerular mesangial cells
REFERENCE   7  (bases 1 to 2176)
  AUTHORS   Lassegue,B., Sorescu,D., Szocs,K., Yin,Q., Akers,M., Zhang,Y.,
            Grant,S.L., Lambeth,J.D. and Griendling,K.K.
  TITLE     Novel gp91(phox) homologues in vascular smooth muscle cells : nox1
            mediates angiotensin II-induced superoxide formation and
            redox-sensitive signaling pathways
  JOURNAL   Circ Res 88 (9), 888-894 (2001)
   PUBMED   11348997
REFERENCE   8  (bases 1 to 2176)
  AUTHORS   Yang,S., Madyastha,P., Bingel,S., Ries,W. and Key,L.
  TITLE     A new superoxide-generating oxidase in murine osteoclasts
  JOURNAL   J Biol Chem 276 (8), 5452-5458 (2001)
   PUBMED   11098048
REFERENCE   9  (bases 1 to 2176)
  AUTHORS   Shiose,A., Kuroda,J., Tsuruya,K., Hirai,M., Hirakata,H., Naito,S.,
            Hattori,M., Sakaki,Y. and Sumimoto,H.
  TITLE     A novel superoxide-producing NAD(P)H oxidase in kidney
  JOURNAL   J Biol Chem 276 (2), 1417-1423 (2001)
   PUBMED   11032835
REFERENCE   10 (bases 1 to 2176)
  AUTHORS   Geiszt,M., Kopp,J.B., Varnai,P. and Leto,T.L.
  TITLE     Identification of renox, an NAD(P)H oxidase in kidney
  JOURNAL   Proc Natl Acad Sci U S A 97 (14), 8010-8014 (2000)
   PUBMED   10869423
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY027527.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY027527.1, AB044086.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760400, SAMEA5760476
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2176
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q32"
     gene            1..2176
                     /gene="Nox4"
                     /note="NADPH oxidase 4"
                     /db_xref="GeneID:85431"
                     /db_xref="RGD:620600"
     exon            1..106
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     CDS             50..1786
                     /gene="Nox4"
                     /EC_number="1.6.3.1"
                     /note="kox-1; kidney superoxide-producing NADPH oxidase;
                     kidney oxidase-1"
                     /codon_start=1
                     /product="NADPH oxidase 4"
                     /protein_id="NP_445976.1"
                     /db_xref="GeneID:85431"
                     /db_xref="RGD:620600"
                     /translation="
MALSWRSWLANEGVKHLCLLVWLSLNVLLFWKTFLLYNQGPEYYYIHQMLGLGLCLSRASASVLNLNCSLILLPMCRTVLAYLRGSQKVPSRRTRRLLDKSKTLHITCGITICIFSGVHVAAHLVNALNFSVNYSEHFLALNAARYQNEDPRKLLFTTVPGLTGVCMVVVLFLMVTASTYAIRVSNYDIFWYTHNLFFVFYMLLLLHVSGGLLKYQTNLDTHPPGCISLNRTPSQNMSIADYVSEHFHGSLPGGFSKLEDHYQKTLVKICLEEPKFQAHFPQTWIWISGPLCLYCAERLYRCIRSNKPVTIISVINHPSDVMELRMIKENFKARPGQYIILHCPSVSALENHPFTLTMCPTETKATFGVHFKVVGDWTERFRDLLLPPSSQDSEILPFIQSRNYPKLYIDGPFGSPFEESLNYEVSLCVAGGIGVTPFASILNTLLDDWKPYKLRRLYFIWVCRDIQSFQWFADLLYVLHNKFWQENRPDFVNIQLYLSQTDGIQKIIGEKYHTLNSRLFIGRPRWKLLFDEIAKCNRGKTVGVFCCGPSSISKTLHNLSNRNNSYGTKFEYNKESFS"
     misc_feature    98..160
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    236..298
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    254..664
                     /gene="Nox4"
                     /note="Ferric reductase like transmembrane component;
                     Region: Ferric_reduct; pfam01794"
                     /db_xref="CDD:426438"
     misc_feature    362..424
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    446..448
                     /gene="Nox4"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q924V1.2); glycosylation site"
     misc_feature    512..574
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    614..676
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    701..868
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     Region: E-loop, essential for H2O2 generating catalytic
                     activity. /evidence=ECO:0000250|UniProtKB:Q9NPH5"
     misc_feature    791..1774
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     Region: Mediates interaction with TLR4.
                     /evidence=ECO:0000250|UniProtKB:Q9NPH5"
     misc_feature    980..1780
                     /gene="Nox4"
                     /note="NADPH oxidase (NOX) catalyzes the generation of
                     reactive oxygen species (ROS) such as superoxide and
                     hydrogen peroxide. ROS were originally identified as
                     bactericidal agents in phagocytes, but are now also
                     implicated in cell signaling and metabolism. NOX...;
                     Region: NOX_Duox_like_FAD_NADP; cd06186"
                     /db_xref="CDD:99783"
     misc_feature    order(1061..1063,1103..1114,1157..1165,1172..1183,
                     1346..1348)
                     /gene="Nox4"
                     /note="FAD binding pocket [chemical binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1103..1105,1109..1114)
                     /gene="Nox4"
                     /note="FAD binding motif [chemical binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    1322..1384
                     /gene="Nox4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2);
                     transmembrane region"
     misc_feature    1331..1363
                     /gene="Nox4"
                     /note="NAD pyrophosphate binding region [chemical
                     binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1331..1333,1343..1354,1358..1360)
                     /gene="Nox4"
                     /note="beta-alpha-beta stucture motif; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1346..1351,1433..1441,1691..1696)
                     /gene="Nox4"
                     /note="NAD binding pocket [chemical binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1427..1432,1439..1441)
                     /gene="Nox4"
                     /note="NADP ribose binding motif [chemical binding]; other
                     site"
                     /db_xref="CDD:99783"
     exon            107..202
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            203..313
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            314..398
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            399..496
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            497..524
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            525..597
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            598..678
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            679..895
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            896..1060
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1061..1123
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1124..1184
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1185..1266
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1267..1386
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1387..1495
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1496..1564
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1565..1665
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
     exon            1666..2176
                     /gene="Nox4"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctttccgtcccaagcaccgagcggagcgcagcacccccgcgccggcggtatggcgctgtcctggaggagctggctggccaacgaaggggttaaacacctctgtctgcttgtttggctgtccctaaatgtcctgcttttctggaaaaccttcctgctgtacaaccaagggccagaatactactacatccaccagatgttgggcctaggattgtgtttgagcagagcttctgcatctgtcctgaacctcaactgcagcctgatccttttacccatgtgccgcacagtcctggcttaccttcgcggatcacagaaggtccctagcaggagaacaagaagattgttggacaaaagcaagactctacatatcacctgtggcataactatttgtattttctcaggtgtgcatgtagctgcccacttggtgaacgccctgaacttctcagtgaactatagtgaacatttccttgcactgaatgcagcaagataccagaatgaggatcccagaaagcttctcttcacaactgttccgggcctgacaggtgtctgcatggtggtggtattgttcctcatggttacagcttctacctatgcaataagagtttctaattatgatatcttctggtatactcacaacctcttctttgtcttctacatgctgctgctgctgcatgtttcgggtggcttgttgaagtatcaaaccaatttagacactcaccctcctggctgtatcagtcttaaccggaccccatctcagaatatgtccatagcagactacgtctcagaacattttcatggatctttgcctggagggttttcaaaattagaagatcattaccagaaaacactggtgaagatttgcctggaagaacccaagttccaagctcatttcccacagacctggatttggatttctggacctttgtgcctatactgtgctgagagactttaccgatgcatccggagcaacaaacctgtcaccattatctcagtaatcaatcatccctcagatgtcatggaactccgtatgatcaaagaaaactttaaagcaagacctggccagtatattattctacattgtcccagtgtatcagcattagaaaaccacccatttactctcacaatgtgtcctactgaaaccaaagcaacatttggtgtccactttaaagtagtaggagactggacagaaagattccgagatttactactgcctccatcaagccaagattctgagattctgcccttcattcaatctagaaactaccccaagttatacattgatggcccatttggaagtccatttgaggagtcactgaactatgaagttagtctgtgtgtggctggaggcattggggtcactccgtttgcatcgatactaaacactctactggatgactggaaaccatacaagctaagaagactgtattttatctgggtctgcagagacatccaatcattccagtggtttgcagacttgctctatgtgctgcataacaagttttggcaagaaaacagacctgactttgtgaacatccagctgtacctcagtcaaacagatgggatacagaagataattggagaaaaataccacacattgaattctagactttttattgggcgtcctcggtggaagcttttatttgatgaaatagcaaaatgtaacagagggaaaacagttggagttttctgctgtggacccagttctatttccaagactcttcataatttgagtaaccggaacaactcatatgggacaaaatttgaatacaataaagaatctttcagctaaaaccttaggagactactgggactctaaagaaggaacaagtgcaatttctaagacttagagactcggctgaatcagacagctatgctatgccaaagaatatcaaagttttgctatttatgattatttaaaatgagaattcaaaaagtgtggcaaaaatgacatggttaatctgcaagccaaaggggccctgaagaatatttgatgtggtgattcacatattgatgggcaaattaaaagaatgctgttagatgcacactgttgatttttatgggaaattcaagaactctctaatgaggagctgaactcactcactctgaagctgatagccacagccctctttaaattgttttcagtcgaacaggttcaaagattgaacaaaattaaaaattc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]