ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-19 07:40:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_031070 3376 bp mRNA linear ROD 23-SEP-2023
DEFINITION Rattus norvegicus neural EGFL like 2 (Nell2), mRNA.
ACCESSION NM_031070 XM_346813
VERSION NM_031070.3
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 3376)
AUTHORS Ha CM, Kim DH, Lee TH, Kim HR, Choi J, Kim Y, Kang D, Park JW,
Ojeda SR, Jeong JK and Lee BJ.
TITLE Transcriptional Regulatory Role of NELL2 in Preproenkephalin Gene
Expression
JOURNAL Mol Cells 45 (8), 537-549 (2022)
PUBMED 35950455
REMARK GeneRIF: Transcriptional Regulatory Role of NELL2 in
Preproenkephalin Gene Expression.
REFERENCE 2 (bases 1 to 3376)
AUTHORS Kim HR, Kim DH, An JY, Kang D, Park JW, Hwang EM, Seo EJ, Jang IH,
Ha CM and Lee BJ.
TITLE NELL2 Function in Axon Development of Hippocampal Neurons
JOURNAL Mol Cells 43 (6), 581-589 (2020)
PUBMED 32597395
REMARK GeneRIF: NELL2 Function in Axon Development of Hippocampal Neurons.
REFERENCE 3 (bases 1 to 3376)
AUTHORS Jeong JK, Kim JG, Kim HR, Lee TH, Park JW and Lee BJ.
TITLE A Role of Central NELL2 in the Regulation of Feeding Behavior in
Rats
JOURNAL Mol Cells 40 (3), 186-194 (2017)
PUBMED 28301916
REMARK GeneRIF: Report shows that neural tissue-enriched multifunctional
protein, NELL2 is a regulatory component of feeding behavior,
possibly through a modulation of neuronal activity in the
hypothalamus.
REFERENCE 4 (bases 1 to 3376)
AUTHORS Zhou SS and Li P.
TITLE Effects of NELL2 on the regulation of GnRH expression and puberty
in female rats
JOURNAL Genet Mol Res 13 (3), 6672-6682 (2014)
PUBMED 25177948
REMARK GeneRIF: Data indicate that RNA interference of NEL-like protein 2
(NELL2) reduced NELL2 and gonadotropin-releasing hormone (GnRH)
expression at multiple stages of sexual development.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 3376)
AUTHORS Ha CM, Hwang EM, Kim E, Lee DY, Chang S, Lee BJ, Hong SG and Park
JY.
TITLE The molecular mechanism of NELL2 movement and secretion in
hippocampal progenitor HiB5 cells
JOURNAL Mol Cells 36 (6), 527-533 (2013)
PUBMED 24352699
REMARK GeneRIF: Results suggest that the N-terminal region of NELL2
determines both the pattern of its intracellular expression and
transport and may affect the cellular activity of cells in a
paracrine or autocrine manner.
REFERENCE 6 (bases 1 to 3376)
AUTHORS Aihara K, Kuroda S, Kanayama N, Matsuyama S, Tanizawa K and Horie
M.
TITLE A neuron-specific EGF family protein, NELL2, promotes survival of
neurons through mitogen-activated protein kinases
JOURNAL Brain Res Mol Brain Res 116 (1-2), 86-93 (2003)
PUBMED 12941464
REFERENCE 7 (bases 1 to 3376)
AUTHORS Kim H, Ha CM, Choi J, Choi EJ, Jeon J, Kim C, Park SK, Kang SS, Kim
K and Lee BJ.
TITLE Ontogeny and the possible function of a novel epidermal growth
factor-like repeat domain-containing protein, NELL2, in the rat
brain
JOURNAL J Neurochem 83 (6), 1389-1400 (2002)
PUBMED 12472893
REMARK GeneRIF: NELL2 may play an important role in the development of the
CNS as well as maintenance of neural functions, by regulating the
intracellular machinery involving Ca2+ signaling, synaptic
transport and/or release of vesicles
REFERENCE 8 (bases 1 to 3376)
AUTHORS Kuroda S and Tanizawa K.
TITLE Involvement of epidermal growth factor-like domain of NELL proteins
in the novel protein-protein interaction with protein kinase C
JOURNAL Biochem Biophys Res Commun 265 (3), 752-757 (1999)
PUBMED 10600492
REFERENCE 9 (bases 1 to 3376)
AUTHORS Kuroda S, Oyasu M, Kawakami M, Kanayama N, Tanizawa K, Saito N, Abe
T, Matsuhashi S and Ting K.
TITLE Biochemical characterization and expression analysis of neural
thrombospondin-1-like proteins NELL1 and NELL2
JOURNAL Biochem Biophys Res Commun 265 (1), 79-86 (1999)
PUBMED 10548494
REFERENCE 10 (bases 1 to 3376)
AUTHORS Beckmann G, Hanke J, Bork P and Reich JG.
TITLE Merging extracellular domains: fold prediction for laminin G-like
and amino-terminal thrombospondin-like modules based on homology to
pentraxins
JOURNAL J Mol Biol 275 (5), 725-730 (1998)
PUBMED 9480764
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JACYVU010000187.1.
On Mar 18, 2021 this sequence version replaced NM_031070.2.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY089719.1, U48245.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
SAMD00155307, SAMEA5760383
[ECO:0000350]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression,
longest protein
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-256 JACYVU010000187.1 13397147-13397402 c
257-342 JACYVU010000187.1 13396473-13396558 c
343-471 JACYVU010000187.1 13395940-13396068 c
472-622 JACYVU010000187.1 13328600-13328750 c
623-796 JACYVU010000187.1 13297859-13298032 c
797-893 JACYVU010000187.1 13297664-13297760 c
894-966 JACYVU010000187.1 13295450-13295522 c
967-1049 JACYVU010000187.1 13295195-13295277 c
1050-1178 JACYVU010000187.1 13294214-13294342 c
1179-1281 JACYVU010000187.1 13292542-13292644 c
1282-1373 JACYVU010000187.1 13254941-13255032 c
1374-1476 JACYVU010000187.1 13251581-13251683 c
1477-1605 JACYVU010000187.1 13242131-13242259 c
1606-1731 JACYVU010000187.1 13208718-13208843 c
1732-1854 JACYVU010000187.1 13162142-13162264 c
1855-1950 JACYVU010000187.1 13159407-13159502 c
1951-2091 JACYVU010000187.1 13100588-13100728 c
2092-2285 JACYVU010000187.1 13090630-13090823 c
2286-2462 JACYVU010000187.1 13089407-13089583 c
2463-2687 JACYVU010000187.1 13087240-13087464 c
2688-3376 JACYVU010000187.1 13077588-13078276 c
FEATURES Location/Qualifiers
source 1..3376
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="7"
/map="7q35"
gene 1..3376
/gene="Nell2"
/note="neural EGFL like 2"
/db_xref="GeneID:81734"
/db_xref="RGD:620999"
exon 1..256
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
misc_feature 135..137
/gene="Nell2"
/note="upstream in-frame stop codon"
exon 257..342
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
CDS 279..2738
/gene="Nell2"
/note="protein kinase C-binding protein NELL2; NEL-like
protein 2; rCG50753-like; NEL-like 2"
/codon_start=1
/product="protein kinase C-binding protein NELL2
precursor"
/protein_id="NP_112332.2"
/db_xref="GeneID:81734"
/db_xref="RGD:620999"
/translation="
MHAMESRVLLRTFCVILGLEAVWGLGVDPSLQIDVLSELELGESTAGVRQVPGLHNGTKAFLFQDSPRSIKAPIATAERFFQKLRNKHEFTILVTLKQIHLNSGVILSIHHLDHRYLELESSGHRNEIRLHYRSGTHRPHTEVFPYILADAKWHKLSLAFSASHLILHIDCNKIYERVVEMPSTDLPLGTTFWLGQRNNAHGYFKGIMQDVQLLVMPQGFIAQCPDLNRTCPTCNDFHGLVQKIMELQDILSKTSAKLSRAEQRMNRLDQCYCERTCTMKGTTYREFESWTDGCKNCTCLNGTIQCETLVCPAPDCPAKSAPAYVDGKCCKECKSTCQFQGRSYFEGERSTVFSASGMCVLYECKDQTMKLVENAGCPALDCPESHQIALSHSCCKVCKGYDFCSEKHTCMENSVCRNLNDRAVCSCRDGFRALREDNAYCEDIDECAEGRHYCRENTMCVNTPGSFLCICQTGYIRIDDYSCTEHDECLTNQHNCDENALCFNTVGGHNCVCKPGYTGNGTTCKAFCKDGCRNGGACIAANVCACPQGFTGPSCETDIDECSEGFVQCDSRANCINLPGWYHCECRDGYHDNGMFAPGGESCEDIDECGTGRHSCANDTICFNLDGGYDCRCPHGKNCTGDCVHDGKVKHNGQIWVLENDRCSVCSCQTGFVMCRRMVCDCENPTVDLSCCPECDPRLSSQCLHQNGETVYNSGDTWVQDCRQCRCLQGEVDCWPLACPEVECEFSVLPENECCPRCVTDPCQADTIRNDITKTCLDEMNVVRFTGSSWIKHGTECTLCQCKNGHVCCSVDPQCLQEL"
sig_peptide 279..350
/gene="Nell2"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 372..929
/gene="Nell2"
/note="Thrombospondin N-terminal -like domains; Region:
TSPN; smart00210"
/db_xref="CDD:214560"
misc_feature 1107..1277
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
misc_feature 1605..1700
/gene="Nell2"
/note="Calcium-binding EGF domain; Region: EGF_CA;
pfam07645"
/db_xref="CDD:429571"
misc_feature 1743..1850
/gene="Nell2"
/note="EGF domain; Region: EGF_3; pfam12947"
/db_xref="CDD:432893"
misc_feature 1950..2054
/gene="Nell2"
/note="Calcium-binding EGF-like domain; Region: EGF_CA;
smart00179"
/db_xref="CDD:214542"
misc_feature order(1950..1952,1959..1961,2007..2009)
/gene="Nell2"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2091..2186
/gene="Nell2"
/note="Calcium-binding EGF domain; Region: EGF_CA;
pfam07645"
/db_xref="CDD:429571"
misc_feature order(2091..2093,2100..2102,2148..2150)
/gene="Nell2"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2205..2363
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
misc_feature 2400..2552
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
exon 343..471
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 472..622
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 623..796
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 797..893
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 894..966
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 967..1049
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1050..1178
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1179..1281
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1282..1373
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1374..1476
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1477..1605
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1606..1731
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1732..1854
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1855..1950
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1951..2091
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2092..2285
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2286..2462
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2463..2687
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2688..3376
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
ORIGIN
gctcactacccatctccgcctgtctccctagcgtgtccagcttcacctaggagtcctgtgtgctttggctgggttccttttcccgcccgggagggggtgccctgcgcctggggctgccgagcggtgtgagcgtctaagtgagggcttccctcttttgcccgaggcggccgggtgcctttctttgcaacctcgccttctgcggctgggtggtcctttctctcgccgggtttggagacacgctcccgatttcgaggggagggagacgatggactgagacgatgcacgccatggaatcccgggtattactgagaacgttctgcgtgatcctcgggctcgaagcggtttggggacttggtgtggacccctccctacagattgacgtcttatcagagttagaacttggggagtccacagctggagtgcgccaagtcccaggactgcataatgggacgaaagccttcctcttccaagattctcccagaagcataaaagcacccattgctacagctgagcggtttttccagaagctgaggaataaacacgagttcacaattctggtgaccctgaaacagatccacttaaattcgggagtcattctctccatccaccacttggatcacaggtacctggaactggaaagcagcggccaccggaatgagatcagactgcattaccgctctggaactcaccgcccgcacacggaagtgtttccttacattttggctgatgccaagtggcacaagctctccttagccttcagtgcctcccacttaattttacacatcgactgcaacaagatctatgaacgagtggtggaaatgccttctacagacttgcctctgggcaccacattttggttgggacagagaaataacgcacacgggtattttaagggaataatgcaagatgtgcaattacttgtcatgccccaggggttcatcgctcagtgcccggatcttaatcgaacctgtccaacatgcaacgacttccatgggcttgtgcagaaaatcatggagctgcaggacattttatcgaagacgtcagccaagttgtctagagctgaacaacgaatgaacaggctggatcagtgctactgtgagcggacgtgcaccatgaagggaaccacctaccgggagttcgagtcctggacagacggctgcaagaactgcacatgcttgaatgggaccatccagtgcgagactctggtctgccctgctcccgactgcccggctaaatcggctccagcgtacgtggatggcaagtgctgtaaggagtgcaagtccacctgccagttccaggggcggagctactttgagggagaaaggagcacagtcttctcagcttccggaatgtgcgtcttgtatgaatgcaaggatcagaccatgaagcttgttgagaacgccggctgcccggctttagattgccccgagtctcatcagatcgccttgtctcacagctgctgcaaggtttgcaaaggttatgacttctgttctgagaagcatacatgcatggagaactcagtctgcaggaacctgaacgacagggcagtgtgcagctgccgggatggtttccgggccctccgggaggacaatgcctactgtgaagacattgacgagtgtgcagaggggcgccattactgccgtgagaacaccatgtgtgtgaacacaccgggctctttcctgtgtatctgccaaacagggtacatcagaatcgacgattactcgtgtacggaacatgacgagtgcctcacaaaccagcacaattgtgacgagaacgctttgtgctttaacaccgttggaggtcacaactgcgtctgcaagcctggctacactgggaatggaaccacgtgcaaagctttctgcaaagacggctgcagaaacggaggtgcctgcattgctgccaatgtctgtgcttgcccacaaggcttcaccggacccagctgtgagacagacattgatgagtgctctgagggctttgttcagtgtgacagccgtgccaactgcattaacctgcctgggtggtaccactgtgagtgcagagatggctaccatgacaatgggatgtttgcaccaggtggagaatcctgtgaagatattgatgaatgtgggactgggaggcacagctgtgccaatgacaccatttgcttcaacttggacggtggctacgattgccggtgtccccatggaaagaactgcacaggggactgcgtgcacgacgggaaagtcaaacacaacggccagatctgggtgctggagaacgacaggtgctctgtgtgttcctgccagactggatttgttatgtgtcgacggatggtctgtgactgcgaaaaccccacagttgacctctcctgctgccctgagtgcgacccaaggctgagcagccagtgcctgcatcaaaacggggaaaccgtgtacaacagcggtgacacctgggtccaggattgccgtcagtgccgctgcttgcaaggagaagttgactgctggcccctggcttgcccagaggtagagtgtgaatttagtgtccttcctgagaacgagtgctgcccacgctgtgtcaccgatccttgtcaggctgacaccatccgcaatgacatcaccaaaacctgcctggacgagatgaacgtggttcgcttcactgggtcttcctggatcaagcacggcacagagtgcaccctctgccagtgcaagaacggccacgtgtgctgctcagtggacccacagtgcctccaggagctgtgaagttaactgcctcatgggagatacctgttcaaagaatgatttctcatttaaaaagaccaaaaaacaaaaaagaaaaaaagtgatgtgcggccagccaaatgcaactgtgtcaatggctgggcagactgatggcgattacggctctgtagagctttgaggaacatcactgaggaaaccagatggcagttccgcctttactgttcctgggatcaccttacggagaaatggctgtgaatcacaggccttgacatccccagccctggagaagaagcctgagcccatcagctctggggaagtctctccctctctccctccctccgcaggcacaggacatgtcctagctcagactcttcctgaaccagcgaggttcctcactgaagccgtggaatgaaaggcagtgagtgagctatattttcagaatccaagaagctgacacatctgtacagtgcactccgaaccctgaaacaagctattgtaatgataaaatactgcacaggcatggttatgtaacattttctaaccggagaagtcaccccacccccatttcctcgtttactgcacttaatgttatttggtttgaatttgttcagtagaagctcgttcttgtgcaaaataaaataactatttctcttacctta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]