2024-05-04 04:16:20, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_019264 1541 bp mRNA linear ROD 22-MAR-2023 DEFINITION Rattus norvegicus protein kinase cAMP-dependent type II regulatory subunit alpha (Prkar2a), mRNA. ACCESSION NM_019264 VERSION NM_019264.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1541) AUTHORS Isensee J, Kaufholz M, Knape MJ, Hasenauer J, Hammerich H, Gonczarowska-Jorge H, Zahedi RP, Schwede F, Herberg FW and Hucho T. TITLE PKA-RII subunit phosphorylation precedes activation by cAMP and regulates activity termination JOURNAL J Cell Biol 217 (6), 2167-2184 (2018) PUBMED 29615473 REMARK GeneRIF: RII phosphorylation precedes cAMP binding and controls the inactivation by modulating the reassociation involving the coordinated action of phosphodiesterases and phosphatases. REFERENCE 2 (bases 1 to 1541) AUTHORS Burgers PP, van der Heyden MA, Kok B, Heck AJ and Scholten A. TITLE A systematic evaluation of protein kinase A-A-kinase anchoring protein interaction motifs JOURNAL Biochemistry 54 (1), 11-21 (2015) PUBMED 25097019 REFERENCE 3 (bases 1 to 1541) AUTHORS Nishimura T, Fujii W, Sugiura K and Naito K. TITLE Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by A-kinase anchor proteins (AKAPs) is required for meiotic arrest of porcine full-grown and growing oocytes JOURNAL Biol Reprod 90 (3), 58 (2014) PUBMED 24501172 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1541) AUTHORS Biesemann C, Gronborg M, Luquet E, Wichert SP, Bernard V, Bungers SR, Cooper B, Varoqueaux F, Li L, Byrne JA, Urlaub H, Jahn O, Brose N and Herzog E. TITLE Proteomic screening of glutamatergic mouse brain synaptosomes isolated by fluorescence activated sorting JOURNAL EMBO J 33 (2), 157-170 (2014) PUBMED 24413018 REFERENCE 5 (bases 1 to 1541) AUTHORS Nishimura T, Sugiura K and Naito K. TITLE A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein kinase (PKA) localization and is involved in meiotic maturation of porcine oocytes JOURNAL Biol Reprod 88 (4), 85 (2013) PUBMED 23426434 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1541) AUTHORS Kultgen PL, Byrd SK, Ostrowski LE and Milgram SL. TITLE Characterization of an A-kinase anchoring protein in human ciliary axonemes JOURNAL Mol Biol Cell 13 (12), 4156-4166 (2002) PUBMED 12475942 REFERENCE 7 (bases 1 to 1541) AUTHORS Dwivedi Y, Rizavi HS and Pandey GN. TITLE Differential effects of haloperidol and clozapine on [(3)H]cAMP binding, protein kinase A (PKA) activity, and mRNA and protein expression of selective regulatory and catalytic subunit isoforms of PKA in rat brain JOURNAL J Pharmacol Exp Ther 301 (1), 197-209 (2002) PUBMED 11907174 REFERENCE 8 (bases 1 to 1541) AUTHORS Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit N and Marks AR. TITLE PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts JOURNAL Cell 101 (4), 365-376 (2000) PUBMED 10830164 REFERENCE 9 (bases 1 to 1541) AUTHORS Feliciello A, Cardone L, Garbi C, Ginsberg MD, Varrone S, Rubin CS, Avvedimento EV and Gottesman ME. TITLE Yotiao protein, a ligand for the NMDA receptor, binds and targets cAMP-dependent protein kinase II(1) JOURNAL FEBS Lett 464 (3), 174-178 (1999) PUBMED 10618500 REFERENCE 10 (bases 1 to 1541) AUTHORS Scott,J.D., Glaccum,M.B., Zoller,M.J., Uhler,M.D., Helfman,D.M., McKnight,G.S. and Krebs,E.G. TITLE The molecular cloning of a type II regulatory subunit of the cAMP-dependent protein kinase from rat skeletal muscle and mouse brain JOURNAL Proc Natl Acad Sci U S A 84 (15), 5192-5196 (1987) PUBMED 3037538 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF533978.1. On Aug 31, 2012 this sequence version replaced NM_019264.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF533978.1, J02934.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132261, SAMD00132262 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1541 AF533978.1 5-1545 FEATURES Location/Qualifiers source 1..1541 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="8" /map="8q32" gene 1..1541 /gene="Prkar2a" /note="protein kinase cAMP-dependent type II regulatory subunit alpha" /db_xref="GeneID:29699" /db_xref="RGD:3393" exon 1..365 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" misc_feature 44..46 /gene="Prkar2a" /note="upstream in-frame stop codon" CDS 110..1315 /gene="Prkar2a" /EC_number="2.7.11.1" /note="protein kinase, cAMP-dependent, regulatory subunit type II alpha; protein kinase, cAMP-dependent, regulatory, type 2, alpha; protein kinase cAMP-dependent type 2 regulatory subunit alpha; protein kinase, cAMP dependent regulatory, type II alpha" /codon_start=1 /product="cAMP-dependent protein kinase type II-alpha regulatory subunit" /protein_id="NP_062137.1" /db_xref="GeneID:29699" /db_xref="RGD:3393" /translation="
MSHIQIPPGLTELLQGYTVEVLRQQPPDLVDFAVEYFTRLREARRQESDSFIAPPTTFHAQESSGVPVIEEDGESESDSDDEDLEVPIPSKFTRRVSVCAETFNPDEEEDNDPRVVHPKTDEQRYRLQEACKDILLFKNLDQEQLSQVLDAMFEKIVKTDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNRGSFGELALMYNTPRAATIVATSDGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLFKSLEMSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIRSKTKTNKNGGNQEVEIAHCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSNLDLLDPGQ"
misc_feature 113..514 /gene="Prkar2a" /note="propagated from UniProtKB/Swiss-Prot (P12368.4); Region: Dimerization and phosphorylation" misc_feature 113..115 /gene="Prkar2a" /note="N-acetylserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); acetylation site" misc_feature 119..241 /gene="Prkar2a" /note="dimerization/docking (D/D) domain of the Type II alpha Regulatory subunit of cAMP-dependent protein kinase; Region: DD_RIIalpha_PKA; cd12103" /db_xref="CDD:438524" misc_feature order(119..133,137..139,146..151,158..163,170..175, 182..184,191..202,206..211,218..223,227..232) /gene="Prkar2a" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature order(125..127,137..142,149..154,161..166,173..178) /gene="Prkar2a" /note="AKAP interaction site [polypeptide binding]; other site" /db_xref="CDD:438524" misc_feature 251..253 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 272..364 /gene="Prkar2a" /note="propagated from UniProtKB/Swiss-Prot (P12368.4); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 332..334 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 338..340 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 398..400 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:16641100, ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature 515..853 /gene="Prkar2a" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(719..724,749..757) /gene="Prkar2a" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature 743..745 /gene="Prkar2a" /note="Phosphothreonine, by PDPK1. /evidence=ECO:0000250|UniProtKB:P00515; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature order(815..823,833..841) /gene="Prkar2a" /note="flexible hinge region; other site" /db_xref="CDD:237999" misc_feature 881..1246 /gene="Prkar2a" /note="effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038" /db_xref="CDD:237999" misc_feature order(1109..1114,1139..1147) /gene="Prkar2a" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:237999" misc_feature 1148..1150 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P13861; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" misc_feature order(1205..1213,1223..1231) /gene="Prkar2a" /note="flexible hinge region; other site" /db_xref="CDD:237999" misc_feature 1283..1285 /gene="Prkar2a" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P12368.4); phosphorylation site" exon 366..401 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 402..451 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 452..535 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 536..642 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 643..796 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 797..898 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 899..973 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 974..1039 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 1040..1181 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" exon 1182..1541 /gene="Prkar2a" /inference="alignment:Splign:2.1.0" ORIGIN
cgggccgcgcgggagacctcgggcgcggagtgactggccggcgtgagggagcgcgcaggttgcggccgccggcggccccgacccgccggccctctcagcggtcgccggcatgagccacatccagatcccaccggggctcacggagctgctgcagggctacaccgtggaggtgcttcggcagcagccgcccgacctcgtcgacttcgcggtggagtacttcacacgcctgcgcgaggcccgccgccaggaatcagactcgttcatcgcccccccgacgacctttcacgcgcaggagtccagcggggtccccgtcatcgaggaggacggggagagtgaatcggactcggacgatgaggatctggaagttccgattcccagcaaatttactagacgagtatcagtctgtgcagaaacgtttaaccctgatgaagaagaagataatgatccaagggtggttcaccccaaaaccgacgagcagaggtacagacttcaggaagcctgtaaagacattctgcttttcaaaaacctggatcaggaacagctttctcaagttctggacgccatgtttgaaaagatagtcaaaactgacgagcatgtcattgaccaaggagatgatggagacaacttttatgtcatagaaaggggaacctatgacattttagtaacaaaagataatcaaacacgatctgttggtcagtatgacaaccgtggcagttttggagaactagccctgatgtacaataccccgagagctgctaccattgtggccacctcagacggctccctttggggattggaccgggtgacttttaggagaatcatagtgaagaacaatgcaaagaagaggaagatgttcgaatcgtttattgagtctgtaccgctctttaaatcactagagatgtcagaacgaatgaagattgtggatgtgatcggggaaaagatctataaggatggagagcgaataatcactcagggtgaaaaggccgacagcttttatattatagagtctggagaagtgagcatcttgattagaagcaagactaaaacgaacaagaacggcgggaaccaggaggttgagattgcccactgccataaggggcagtactttggagaacttgccctggtgaccaacaaaccaagagctgcttctgcttatgcggttggagacgtcaaatgcttagtcatggatgttcaagcatttgagaggcttctgggcccctgcatggacatcatgaagaggaacatctcacattacgaagaacagctggtgaagatgtttggctccaacttggatctattggaccccgggcagtagatgtgatgaatctcggagccttctcagtgtgataccaaatccttccagtcagccacaagaacacacccagaaaacagacacgacagaactgcgcctgctgctgtctctgctgctgccatcgctgtggtaaagggcacttagaagtcttgaaagatggacagaggctctacccacacccaccttccactttgcttctgaacgccgtcattagaccacttatgtcacg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]