ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-11-01 10:23:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_013181 1434 bp mRNA linear ROD 24-JUN-2024
DEFINITION Rattus norvegicus protein kinase cAMP-dependent type I regulatory
subunit alpha (Prkar1a), mRNA.
ACCESSION NM_013181 XM_579380
VERSION NM_013181.2
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 1434)
AUTHORS Kim,J., Kwon,J.T., Jeong,J., Kim,J., Hong,S.H., Kim,J., Park,Z.Y.,
Chung,K.H., Eddy,E.M. and Cho,C.
TITLE SPATC1L maintains the integrity of the sperm head-tail junction
JOURNAL EMBO Rep 19 (9) (2018)
PUBMED 30026308
REFERENCE 2 (bases 1 to 1434)
AUTHORS Gilbert,M.L., Yang,L., Su,T. and McKnight,G.S.
TITLE Expression of a dominant negative PKA mutation in the kidney
elicits a diabetes insipidus phenotype
JOURNAL Am J Physiol Renal Physiol 308 (6), F627-F638 (2015)
PUBMED 25587115
REMARK GeneRIF: role for PKA signaling in both short- and long-term
regulation of AQP2, characterizing a novel mouse model of diabetes
insipidus
REFERENCE 3 (bases 1 to 1434)
AUTHORS Burgers,P.P., van der Heyden,M.A., Kok,B., Heck,A.J. and
Scholten,A.
TITLE A systematic evaluation of protein kinase A-A-kinase anchoring
protein interaction motifs
JOURNAL Biochemistry 54 (1), 11-21 (2015)
PUBMED 25097019
REFERENCE 4 (bases 1 to 1434)
AUTHORS Nishimura,T., Fujii,W., Sugiura,K. and Naito,K.
TITLE Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
porcine full-grown and growing oocytes
JOURNAL Biol Reprod 90 (3), 58 (2014)
PUBMED 24501172
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1434)
AUTHORS Biesemann,C., Gronborg,M., Luquet,E., Wichert,S.P., Bernard,V.,
Bungers,S.R., Cooper,B., Varoqueaux,F., Li,L., Byrne,J.A.,
Urlaub,H., Jahn,O., Brose,N. and Herzog,E.
TITLE Proteomic screening of glutamatergic mouse brain synaptosomes
isolated by fluorescence activated sorting
JOURNAL EMBO J 33 (2), 157-170 (2014)
PUBMED 24413018
REFERENCE 6 (bases 1 to 1434)
AUTHORS Lazar,S., Galiani,D. and Dekel,N.
TITLE cAMP-Dependent PKA negatively regulates polyadenylation of c-mos
mRNA in rat oocytes
JOURNAL Mol Endocrinol 16 (2), 331-341 (2002)
PUBMED 11818504
REMARK GeneRIF: cAMP-Dependent PKA negatively regulates polyadenylation of
c-mos mRNA in rat oocytes
REFERENCE 7 (bases 1 to 1434)
AUTHORS Kirschner,L.S., Carney,J.A., Pack,S.D., Taymans,S.E., Giatzakis,C.,
Cho,Y.S., Cho-Chung,Y.S. and Stratakis,C.A.
TITLE Mutations of the gene encoding the protein kinase A type I-alpha
regulatory subunit in patients with the Carney complex
JOURNAL Nat Genet 26 (1), 89-92 (2000)
PUBMED 10973256
REFERENCE 8 (bases 1 to 1434)
AUTHORS Imaizumi-Scherrer,T., Faust,D.M., Benichou,J.C., Hellio,R. and
Weiss,M.C.
TITLE Accumulation in fetal muscle and localization to the neuromuscular
junction of cAMP-dependent protein kinase A regulatory and
catalytic subunits RI alpha and C alpha
JOURNAL J Cell Biol 134 (5), 1241-1254 (1996)
PUBMED 8794865
REFERENCE 9 (bases 1 to 1434)
AUTHORS Greene,R.M., Lloyd,M.R., Uberti,M., Nugent,P. and Pisano,M.M.
TITLE Patterns of cyclic AMP-dependent protein kinase gene expression
during ontogeny of the murine palate
JOURNAL J Cell Physiol 163 (3), 431-440 (1995)
PUBMED 7775586
REFERENCE 10 (bases 1 to 1434)
AUTHORS Kuno,T., Ono,Y., Hirai,M., Hashimoto,S., Shuntoh,H. and Tanaka,C.
TITLE Molecular cloning and cDNA structure of the regulatory subunit of
type I cAMP-dependent protein kinase from rat brain
JOURNAL Biochem Biophys Res Commun 146 (2), 878-883 (1987)
PUBMED 3619906
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from
JAXUCZ010000010.1.
On Nov 26, 2020 this sequence version replaced NM_013181.1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: M17086.1, SRR22399484.1275394.1
[ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA5760383, SAMEA5760386
[ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-89 JAXUCZ010000010.1 95120537-95120625
90-272 JAXUCZ010000010.1 95123812-95123994
273-443 JAXUCZ010000010.1 95129397-95129567
444-535 JAXUCZ010000010.1 95130302-95130393
536-597 JAXUCZ010000010.1 95130563-95130624
598-644 JAXUCZ010000010.1 95131564-95131610
645-803 JAXUCZ010000010.1 95132272-95132430
804-864 JAXUCZ010000010.1 95134126-95134186
865-986 JAXUCZ010000010.1 95135161-95135282
987-1068 JAXUCZ010000010.1 95136017-95136098
1069-1434 JAXUCZ010000010.1 95136800-95137165
FEATURES Location/Qualifiers
source 1..1434
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="10"
/map="10q32.1"
gene 1..1434
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="protein kinase cAMP-dependent type I regulatory
subunit alpha"
/db_xref="GeneID:25725"
/db_xref="RGD:3391"
exon 1..89
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
misc_feature 69..71
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="upstream in-frame stop codon"
exon 90..272
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
CDS 96..1241
/gene="Prkar1a"
/gene_synonym="RIIA"
/EC_number="2.7.11.1"
/note="protein kinase cAMP-dependent type 1 regulatory
subunit alpha; protein kinase, cAMP-dependent, regulatory,
type I, alpha; protein kinase, cAMP-dependent, regulatory
subunit type I alpha"
/codon_start=1
/product="cAMP-dependent protein kinase type I-alpha
regulatory subunit"
/protein_id="NP_037313.1"
/db_xref="GeneID:25725"
/db_xref="RGD:3391"
/translation="
MASGSMAASEEERSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEARQIQSLQKSGIRTDSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFPVSFIAGETVIQQGDEGDNFYVIDQGEMDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGIDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGTAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV"
misc_feature 96..98
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="N-acetylmethionine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P09456.2); acetylation site"
misc_feature 99..503
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="propagated from UniProtKB/Swiss-Prot (P09456.2);
Region: Dimerization and phosphorylation"
misc_feature 99..101
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="N-acetylalanine, in cAMP-dependent protein kinase
type I-alpha regulatory subunit, N-terminally processed.
/evidence=ECO:0000250|UniProtKB:P00514; propagated from
UniProtKB/Swiss-Prot (P09456.2); acetylation site"
misc_feature 102..104
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature 135..284
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="dimerization/docking (D/D) domain of the Type I
alpha Regulatory subunit of cAMP-dependent protein kinase;
Region: DD_RIalpha_PKA; cd12101"
/db_xref="CDD:438522"
misc_feature order(138..140,147..152,177..182,186..191,198..203)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="AKAP interaction site [polypeptide binding]; other
site"
/db_xref="CDD:438522"
misc_feature order(147..149,156..161,174..176,183..188,195..200,
207..212,222..224,228..239,243..248,255..260,267..269)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:438522"
misc_feature 288..383
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="propagated from UniProtKB/Swiss-Prot (P09456.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 318..320
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphothreonine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature 324..326
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P10644; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature 342..344
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature 381..395
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="propagated from UniProtKB/Swiss-Prot (P09456.2);
Region: Pseudophosphorylation motif"
misc_feature 396..398
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9DBC7; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature 504..833
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="effector domain of the CAP family of transcription
factors; members include CAP (or cAMP receptor protein
(CRP)), which binds cAMP, FNR (fumarate and nitrate
reduction), which uses an iron-sulfur cluster to sense
oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
cd00038"
/db_xref="CDD:237999"
misc_feature order(696..701,726..734)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:237999"
misc_feature order(792..800,810..818)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="flexible hinge region; other site"
/db_xref="CDD:237999"
misc_feature 858..1205
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="effector domain of the CAP family of transcription
factors; members include CAP (or cAMP receptor protein
(CRP)), which binds cAMP, FNR (fumarate and nitrate
reduction), which uses an iron-sulfur cluster to sense
oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
cd00038"
/db_xref="CDD:237999"
misc_feature 867..869
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (P09456.2); phosphorylation site"
misc_feature order(1068..1073,1098..1106)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:237999"
misc_feature order(1164..1172,1182..1190)
/gene="Prkar1a"
/gene_synonym="RIIA"
/note="flexible hinge region; other site"
/db_xref="CDD:237999"
exon 273..443
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 444..535
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 536..597
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 598..644
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 645..803
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 804..864
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 865..986
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 987..1068
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
exon 1069..1434
/gene="Prkar1a"
/gene_synonym="RIIA"
/inference="alignment:Splign:2.1.0"
ORIGIN
ggcgttgagggaggcagacgcgaggaggaacggaggagaggcggagatcaccgaacagcagaacaatctagaggatccctcgacacctgagaaccatggcgtctggcagtatggcagccagtgaggaagagcggagtctccgggaatgcgagctctatgtgcagaagcacaacatccaggccctgctgaaggactccatcgtgcagctgtgcactgctcggcccgagaggcccatggcattccttcgggaatactttgagaggctggagaaggaggaggcaagacagattcagagcctacagaaatccggcattcgtacagactcgagggaggatgagatctctcctccacccccaaatccggtggtgaagggccgtcggcgccgcggtgctatcagcgctgaggtttacactgaggaagatgctgcgtcctacgttagaaaggttataccaaaagattataagacaatggctgctttagccaaggccatcgaaaagaacgtgttattttcacaccttgatgacaatgagagaagtgacatttttgatgcaatgtttccagtctcctttattgctggagagacagttattcagcaaggggatgaaggggataacttctatgtgattgatcaaggagaaatggatgtgtatgtcaataatgaatgggcaaccagtgttggggaaggagggagctttggagagctggctttgatttacggaacacccagagcagccactgtcaaagcaaagacaaacgtgaaactgtggggcattgaccgagacagctaccggagaatcctcatgggaagcactctgcgaaagaggaagatgtatgaagaatttcttagtaaagtgtctattttagagtctctggacaagtgggagcgtctcacagtagctgatgcactggagcctgtccagtttgaagatggacagaagattgtggtgcaaggagaaccgggggatgagttcttcattattttagagggcacggccgctgtgctgcagcgtcggtcagaaaacgaagagtttgttgaagtgggacgcctggggccttctgactattttggtgaaattgccctgctgatgaatcgtcctcgggctgccactgtggttgcgcgtggccctttgaagtgcgttaagttggaccgacctcggtttgaacgcgtccttggcccatgctcagatatcctcaagcgaaacatccagcagtacaacagctttgtgtcactgtccgtctgagatccgcctcctgtgcctctcctccccagtctatgcttcactcacgcagactgctttctcctccctctctgcagcgccaagtggccactggcttcacagcttcttgtctctgtatactaaaggttgctttattgcaccattttccattggagcgttactgaatgctcactcacaaataaatagagttgtatgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]