ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-11-01 10:21:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_001399169 2195 bp mRNA linear ROD 24-JUN-2024
DEFINITION Rattus norvegicus solute carrier family 11 member 2 (Slc11a2),
transcript variant 2, mRNA.
ACCESSION NM_001399169 XM_006242311
VERSION NM_001399169.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2195)
AUTHORS Liang,T., Yang,S.X., Qian,C., Du,L.D., Qian,Z.M., Yung,W.H. and
Ke,Y.
TITLE HMGB1 Mediates Inflammation-Induced DMT1 Increase and Dopaminergic
Neurodegeneration in the Early Stage of Parkinsonism
JOURNAL Mol Neurobiol 61 (4), 2006-2020 (2024)
PUBMED 37833459
REMARK GeneRIF: HMGB1 Mediates Inflammation-Induced DMT1 Increase and
Dopaminergic Neurodegeneration in the Early Stage of Parkinsonism.
REFERENCE 2 (bases 1 to 2195)
AUTHORS Irollo,E., Nash,B., Luchetta,J., Brandimarti,R. and Meucci,O.
TITLE The Endolysosomal Transporter DMT1 is Required for Morphine
Regulation of Neuronal Ferritin Heavy Chain
JOURNAL J Neuroimmune Pharmacol 18 (3), 495-508 (2023)
PUBMED 37661197
REMARK GeneRIF: The Endolysosomal Transporter DMT1 is Required for
Morphine Regulation of Neuronal Ferritin Heavy Chain.
REFERENCE 3 (bases 1 to 2195)
AUTHORS Wolff,N.A., Garrick,M.D., Zhao,L., Garrick,L.M., Ghio,A.J. and
Thevenod,F.
TITLE A role for divalent metal transporter (DMT1) in mitochondrial
uptake of iron and manganese
JOURNAL Sci Rep 8 (1), 211 (2018)
PUBMED 29317744
REMARK GeneRIF: DMT1 mediates mitochondrial Fe2+ and Mn2+ acquisition.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2195)
AUTHORS Naito,Y., Sawada,H., Oboshi,M., Okuno,K., Yasumura,S., Okuhara,Y.,
Eguchi,A., Nishimura,K., Soyama,Y., Asakura,M., Ishihara,M.,
Tsujino,T. and Masuyama,T.
TITLE Altered expression of intestinal duodenal cytochrome b and divalent
metal transporter 1 might be associated with cardio-renal anemia
syndrome
JOURNAL Heart Vessels 32 (11), 1410-1414 (2017)
PUBMED 28669019
REMARK GeneRIF: impaired intestinal expression of Dcyt-b and DMT-1 might
be associated with the reduction of an iron uptake in CKD. Taken
together, impaired these intestinal iron transporters may become a
novel therapeutic target for cardio-renal anemia syndrome.
REFERENCE 5 (bases 1 to 2195)
AUTHORS Mackenzie,K., Foot,N.J., Anand,S., Dalton,H.E., Chaudhary,N.,
Collins,B.M., Mathivanan,S. and Kumar,S.
TITLE Regulation of the divalent metal ion transporter via membrane
budding
JOURNAL Cell Discov 2, 16011 (2016)
PUBMED 27462458
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 2195)
AUTHORS Fleming,M.D., Trenor,C.C. 3rd, Su,M.A., Foernzler,D., Beier,D.R.,
Dietrich,W.F. and Andrews,N.C.
TITLE Microcytic anaemia mice have a mutation in Nramp2, a candidate iron
transporter gene
JOURNAL Nat Genet 16 (4), 383-386 (1997)
PUBMED 9241278
REFERENCE 7 (bases 1 to 2195)
AUTHORS Sassa,S. and Bernstein,S.E.
TITLE Studies of erythrocyte protoporphyrin in anemic mutant mice: use of
a modified hematofluorometer for the detection of heterozygotes for
hemolytic disease
JOURNAL Exp Hematol 6 (5), 479-487 (1978)
PUBMED 658175
REFERENCE 8 (bases 1 to 2195)
AUTHORS Edwards,J.A. and Hoke,J.E.
TITLE Red cell iron uptake in hereditary microcytic anemia
JOURNAL Blood 46 (3), 381-388 (1975)
PUBMED 807277
REFERENCE 9 (bases 1 to 2195)
AUTHORS Kreimer-Birnbaum,M., Bannerman,R.M., Russell,E.S. and
Bernstein,S.E.
TITLE Pyrrole pigments in normal and congenitally anaemic mice (+:+, W-W
v, ha-ha, nb-nb, mk-mk, f-f and sla-Y)
JOURNAL Comp Biochem Physiol A Comp Physiol 43 (1), 21-30 (1972)
PUBMED 4404581
REFERENCE 10 (bases 1 to 2195)
AUTHORS Bannerman,R.M., Edwards,J.A., Kreimer-Birnbaum,M., McFarland,E. and
Russell,E.S.
TITLE Hereditary microcytic anaemia in the mouse; studies in iron
distribution and metabolism
JOURNAL Br J Haematol 23 (2), 235-245 (1972)
PUBMED 5070129
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JAXUCZ010000007.1.
On Jan 4, 2022 this sequence version replaced XM_006242311.4.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR22582416.588831.1,
SRR26360181.724305.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA5760383,
SAMEA5760386 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on expression
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-91 JAXUCZ010000007.1 133417698-133417788 c
92-163 JAXUCZ010000007.1 133406596-133406667 c
164-312 JAXUCZ010000007.1 133404638-133404786 c
313-438 JAXUCZ010000007.1 133403987-133404112 c
439-558 JAXUCZ010000007.1 133402477-133402596 c
559-665 JAXUCZ010000007.1 133399910-133400016 c
666-736 JAXUCZ010000007.1 133399153-133399223 c
737-804 JAXUCZ010000007.1 133398976-133399043 c
805-960 JAXUCZ010000007.1 133397471-133397626 c
961-1119 JAXUCZ010000007.1 133396824-133396982 c
1120-1206 JAXUCZ010000007.1 133395452-133395538 c
1207-1326 JAXUCZ010000007.1 133394665-133394784 c
1327-1476 JAXUCZ010000007.1 133394384-133394533 c
1477-1550 JAXUCZ010000007.1 133392637-133392710 c
1551-1704 JAXUCZ010000007.1 133390618-133390771 c
1705-1758 JAXUCZ010000007.1 133388640-133388693 c
1759-2195 JAXUCZ010000007.1 133381878-133382314 c
FEATURES Location/Qualifiers
source 1..2195
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="7"
/map="7q36"
gene 1..2195
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="solute carrier family 11 member 2"
/db_xref="GeneID:25715"
/db_xref="RGD:3684"
exon 1..91
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 92..163
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
CDS 130..1836
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="isoform 2 is encoded by transcript variant 2;
DMT-1; NRAMP 2; divalent cation transporter 1; natural
resistance-associated macrophage protein 2; solute carrier
family 11 (proton-coupled divalent metal ion
transporters), member 2; Solute carrier family 11 member 2
(natural resistance-associated macrophage protein 2);
divalent metal transporter 1; solute carrier family 11
(proton-coupled divalent metal ion transporter), member 2"
/codon_start=1
/product="natural resistance-associated macrophage protein
2 isoform 2"
/protein_id="NP_001386098.1"
/db_xref="GeneID:25715"
/db_xref="RGD:3684"
/translation="
MVLDPEEKIPDDGASGDHGDSASLGAINPAYSNSSLPHSTGDSEEPFTTYFDEKIPIPEEEYSCFSFRKLWAFTGPGFLMSIAYLDPGNIESDLQSGAVAGFKLLWVLLLATIVGLLLQRLAARLGVVTGLHLAEVCHRQYPKVPRIILWLMVELAIIGSDMQEVIGSAIAINLLSAGRVPLYGGVLITIADTFVFLFLDKYGLRKLEAFFGFLITIMALTFGYEYVTVKPSQSQVLRGMFVPSCSGCHTPQVEQAVGIVGAVIMPHNMYLHSALVKSRQVNRANKQEVREANKYFFIESCIALFVSFIINVFVVSVFAEAFFEKTNEQVVEVCRNSSSPHADLFPNDNSTLAVDIYKGGVVLGCYFGPAALYIWAVGILAAGQSSTMTGTYSGQFVMEGFLNLKWSRFARVILTRSIAIIPTLLVAVFQDVEHLTGMNDFLNVLQSLQLPFALIPILTFTSLRPVMSEFSNGIGWRIAGGILVLLVCSINMYFVVVYVQELGHVALYVVAAVVSVAYLGFVFYLGWQCLIALGLSFLDCGRSYHLGLTARPELYLLNTVDAVSLVSR"
misc_feature 130..264
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 331..1530
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="NRAMP (natural resistance-associated macrophage
protein) metal ion transporters; Region: nramp; TIGR01197"
/db_xref="CDD:162246"
misc_feature 337..399
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 415..480
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 592..654
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 667..711
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 754..816
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 895..957
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1033..1095
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1135..1137
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (O54902.1); glycosylation site"
misc_feature 1174..1176
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (O54902.1); glycosylation site"
misc_feature 1210..1272
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1354..1416
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1450..1512
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1576..1638
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1648..1710
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
transmembrane region"
misc_feature 1792..1806
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="propagated from UniProtKB/Swiss-Prot (O54902.1);
Region: Required for early endosome targeting.
/evidence=ECO:0000250|UniProtKB:P49281"
misc_feature 1795..1797
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (O54902.1); phosphorylation site"
misc_feature 1819..1821
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P49282; propagated from
UniProtKB/Swiss-Prot (O54902.1); phosphorylation site"
misc_feature 1828..1830
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P49282; propagated from
UniProtKB/Swiss-Prot (O54902.1); phosphorylation site"
exon 164..312
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 313..438
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 439..558
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 559..665
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 666..736
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 737..804
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 805..960
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 961..1119
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1120..1206
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1207..1326
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1327..1476
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1477..1550
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1551..1704
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1705..1758
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
exon 1759..2195
/gene="Slc11a2"
/gene_synonym="Dmt1; Nramp2"
/inference="alignment:Splign:2.1.0"
ORIGIN
caatcacgggagggcaggaggtggactgggtcggcgctggctcctgggatatggagtcgccggcgcggcgtgtcaggaggtggtggagccgaatcctattctaagagcacagatcctcaggtatctaccatggtgttggatcctgaagaaaagattccagacgatggtgcttctggggaccatggagactcggccagcctcggtgccatcaaccctgcttacagcaactcttccctcccacattccaccggggattctgaggagcccttcaccacctactttgatgagaaaatccccattcctgaggaggagtactcttgttttagtttccgtaaactctgggccttcacaggacctggttttcttatgagcattgcctacctggatccaggaaacattgaatctgatttacagtctggagcagtggctggatttaagttgctctgggtgctcctgctggccactattgtggggctgctgctccagcgtctcgcagctcgactgggagtggtcaccggcttgcaccttgctgaagtgtgtcaccgtcagtatcccaaggtcccacggatcatcctgtggctaatggtggagttggcaatcattggttctgatatgcaggaagtcattggctcagccatcgccatcaatctcctgtctgccggaagggttcccctgtatggtggagtcctcatcaccatcgcagatacttttgtatttctctttttggacaaatatggcttgcggaagctggaagcattttttggctttctcatcactatcatggccctcacatttggatatgagtatgttacagtgaaacccagccaaagccaagtactcaggggcatgttcgtgccatcctgttcaggctgccacacccctcaggtggagcaggcggtgggcatcgtgggagctgtgatcatgccacacaacatgtacctgcactctgccttagtcaagtctagacaagtgaaccgggccaataagcaggaagttcgagaagccaataagtacttcttcatcgagtcctgcattgcactctttgtttccttcatcatcaatgtctttgtcgtctccgtctttgctgaagcattttttgagaaaaccaatgagcaggtggttgaggtctgcagaaatagcagcagcccccatgctgacctctttcctaacgacaactctaccctggctgtggacatctacaaagggggtgttgtgcttggatgttacttcgggcctgcggccctctacatctgggcggtggggatcctggctgctggacagagctccaccatgactggaacctattctggccagtttgtcatggagggattcctgaacctaaaatggtcgcgctttgcccgcgtgatcctgaccaggtctattgccatcatccctaccctgcttgttgctgtcttccaagatgtggagcatctgacagggatgaatgatttcctgaatgttctgcagagcctacagctcccctttgccctcatccctatcctcaccttcacaagcctgcggccagtgatgagtgagttctccaacggaataggctggaggatcgcaggcggcatcttggtccttctcgtctgctccatcaacatgtactttgtcgtggtctacgtccaggagctagggcatgtggcactgtatgtggtggctgcagtggttagcgtggcttatctgggctttgtgttctacttgggttggcagtgtttgattgcgttgggcctgtcgttcctggactgtgggcgctcgtaccacctcggactgaccgctaggcctgaactctacctcctgaacaccgtggacgccgtctcgctggtatctagatgaccaacagcccagaagactttaagaacactttctctaagcccttttgtgccaagtgtctgttagcaaatcccttagttcagaggtgaacttgttcaaatgttttgaaccaaggcgaagaagatctggaggagtcgggtaaagctaatggctgtgaatgggtcagagaccccctcacctgcagcagtcattaacgtagcgggaggcaaacagcgggcctgtggcagccctgcagtcccgcacgcaggcttgtgtctgcacctctggggtttaaaatgtatggatagatatatttatgtggacccaaacgtgccagtttgggtaagattttaaagttataaaacttgatagatttttacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]