LOCUS       NM_001108348            1908 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus LIM homeobox 4 (Lhx4), mRNA.
ACCESSION   NM_001108348 XM_001072440 XM_039090907 XM_341135
VERSION     NM_001108348.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1908)
  AUTHORS   Hertz H, Carstensen MB, Bering T, Rohde K, Moller M, Granau AM,
            Coon SL, Klein DC and Rath MF.
  TITLE     The Lhx4 homeobox transcript in the rat pineal gland: Adrenergic
            regulation and impact on transcripts encoding
            melatonin-synthesizing enzymes
  JOURNAL   J Pineal Res 68 (1), e12616 (2020)
   PUBMED   31609018
  REMARK    GeneRIF: The current study was undertaken to clarify the mechanisms
            driving rhythmic LIM homeobox 4 (Lhx4) expression in the pineal
            gland and the possible regulatory impact of Lhx4 on gene
            transcripts involved in melatonin synthesis and other biological
            processes.
REFERENCE   2  (bases 1 to 1908)
  AUTHORS   Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S,
            Das PK, Kivioja T, Dave K, Zhong F, Nitta KR, Taipale M, Popov A,
            Ginno PA, Domcke S, Yan J, Schubeler D, Vinson C and Taipale J.
  TITLE     Impact of cytosine methylation on DNA binding specificities of
            human transcription factors
  JOURNAL   Science 356 (6337) (2017)
   PUBMED   28473536
REFERENCE   3  (bases 1 to 1908)
  AUTHORS   Tian G, Singh U, Yu Y, Ellsworth BS, Hemberger M, Geyer R, Stewart
            MD, Behringer RR and Fundele R.
  TITLE     Expression and function of the LIM homeobox containing genes Lhx3
            and Lhx4 in the mouse placenta
  JOURNAL   Dev Dyn 237 (5), 1517-1525 (2008)
   PUBMED   18425848
REFERENCE   4  (bases 1 to 1908)
  AUTHORS   Machinis K and Amselem S.
  TITLE     Functional relationship between LHX4 and POU1F1 in light of the
            LHX4 mutation identified in patients with pituitary defects
  JOURNAL   J Clin Endocrinol Metab 90 (9), 5456-5462 (2005)
   PUBMED   15998782
REFERENCE   5  (bases 1 to 1908)
  AUTHORS   Raetzman LT, Ward R and Camper SA.
  TITLE     Lhx4 and Prop1 are required for cell survival and expansion of the
            pituitary primordia
  JOURNAL   Development 129 (18), 4229-4239 (2002)
   PUBMED   12183375
REFERENCE   6  (bases 1 to 1908)
  AUTHORS   Arber S, Han B, Mendelsohn M, Smith M, Jessell TM and Sockanathan
            S.
  TITLE     Requirement for the homeobox gene Hb9 in the consolidation of motor
            neuron identity
  JOURNAL   Neuron 23 (4), 659-674 (1999)
   PUBMED   10482234
REFERENCE   7  (bases 1 to 1908)
  AUTHORS   Sharma K, Sheng HZ, Lettieri K, Li H, Karavanov A, Potter S,
            Westphal H and Pfaff SL.
  TITLE     LIM homeodomain factors Lhx3 and Lhx4 assign subtype identities for
            motor neurons
  JOURNAL   Cell 95 (6), 817-828 (1998)
   PUBMED   9865699
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000243.1.
            
            On or before Mar 12, 2021 this sequence version replaced
            XM_039090907.1, NM_001108348.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-318               JACYVU010000243.1  2773569-2773886     c
            319-490             JACYVU010000243.1  2755995-2756166     c
            491-693             JACYVU010000243.1  2740743-2740945     c
            694-848             JACYVU010000243.1  2737217-2737371     c
            849-1020            JACYVU010000243.1  2736747-2736918     c
            1021-1908           JACYVU010000243.1  2733776-2734663     c
FEATURES             Location/Qualifiers
     source          1..1908
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="13"
                     /map="13q21"
     gene            1..1908
                     /gene="Lhx4"
                     /note="LIM homeobox 4"
                     /db_xref="GeneID:360858"
                     /db_xref="RGD:1308044"
     exon            1..318
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    129..131
                     /gene="Lhx4"
                     /note="upstream in-frame stop codon"
     CDS             243..1415
                     /gene="Lhx4"
                     /note="LIM homeobox protein 4"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx4"
                     /protein_id="NP_001101818.2"
                     /db_xref="GeneID:360858"
                     /db_xref="RGD:1308044"
                     /translation="

MMQSAAVPAEGAVKGLPEMLGVPMQQIPQCAGCNQHILDKFILKVLDRHWHSSCLKCADCQMQLADRCFSRAGSVYCKEDFFKRFGTKCTACQQGIPPTQVVRKAQDFVYHLHCFACIICNRQLATGDEFYLMEDGRLVCKEDYETAKQNDDSEAGAKRPRTTITAKQLETLKNAYKNSPKPARHVREQLSSETGLDMRVVQVWFQNRRAKEKRLKKDAGRHRWGQFYKSVKRSRGGSKQEKESSAEDCGVSDSELSFREDQILSELGHTNRIYGNVGDVTGGQLMNGSFSMDGTGQSYQDLRDGSPYGIPQSPSSISSLPSHAPLLSGLDYTVDSNLGVIAHPGQGVSQTLRAMAGGPTSDLSTGSSVGYPDFPTSPASWLDEMDHPPF"

     misc_feature    330..485
                     /gene="Lhx4"
                     /note="The first LIM domain of Lhx4; Region: LIM1_Lhx4;
                     cd09468"
                     /db_xref="CDD:188852"
     misc_feature    order(330..332,339..341,393..395,402..404,411..413,
                     420..422,471..473,480..482)
                     /gene="Lhx4"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188852"
     misc_feature    507..674
                     /gene="Lhx4"
                     /note="The second LIM domain of Lhx3-Lhx4 family; Region:
                     LIM2_Lhx3_Lhx4; cd09376"
                     /db_xref="CDD:188762"
     misc_feature    order(507..509,516..518,573..575,582..584,591..593,
                     600..602,660..662,669..671)
                     /gene="Lhx4"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(543..545,618..620)
                     /gene="Lhx4"
                     /note="Isl binding site; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(714..728,732..734,783..785,801..803,840..842,
                     846..851,858..863,867..875,879..884)
                     /gene="Lhx4"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    720..881
                     /gene="Lhx4"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(720..722,729..731,849..851,858..863,870..872)
                     /gene="Lhx4"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            319..490
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
     exon            491..693
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
     exon            694..848
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
     exon            849..1020
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
     exon            1021..1908
                     /gene="Lhx4"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cccgggatgtgcaccagcccgggagagcgagatcaaagggatttgaaacagcctgaggactggaggggggagggggccggccagcttgtggagtcctcccggagaggcggagggctcggcttcctctgtgacttcagcggcctggttggttttattattattattttcaaatctccgaatccagccagagggagagagcgagagatctcggtagactgcgacttgctgcctctggctccaagatgatgcagagcgcggctgtccccgcggagggggctgtcaaggggctcccggagatgctcggtgtgccgatgcaacagattccccagtgcgccggttgcaaccagcacatcctggataagttcatcctgaaggtcctggacagacactggcacagctcctgcctcaagtgtgcagactgccagatgcagctagctgacaggtgcttctccagggccgggagtgtctactgcaaagaagattttttcaagcgctttggcacaaaatgcacagcgtgccagcagggcatccccccgacccaggtggttcgcaaggctcaggacttcgtctatcacctgcactgctttgcctgcatcatctgcaaccggcagctggccacgggggacgagttctaccttatggaggatggccggctagtgtgcaaggaagactacgagacagccaagcagaacgatgactcggaggctggggcgaagcggccgcggaccaccatcacggcaaagcagctggagacactaaagaatgcatacaagaactccccaaagcctgcccggcatgtgagggagcagctctcctccgagacaggcctggacatgagagtggtacaggtttggtttcagaacagaagggccaaggagaaaaggctgaagaaggacgcggggcggcatcgttgggggcagttctacaagagcgtcaagaggagccggggaggcagcaagcaggagaaggagagctcagcagaggactgtggggttagtgacagtgagctgagcttccgagaagatcaaatactctcagagcttggccacaccaataggatttatggcaacgtgggggacgttacaggcggacagttaatgaatgggagcttctccatggatgggacaggacaatcctatcaggacttgagggatgggagcccctatggaatcccccagtctccatcctccatatcgtccttgccatcccatgctcctttgctcagtgggctggattacacagtggacagtaatctgggcgtcattgcccatccagggcagggagtaagccagacactgagagccatggctggggggcccacctctgacctctcgacaggaagcagtgtaggctaccctgattttccaactagcccagcctcctggcttgatgaaatggaccatcctcctttttagaccttccttgccaccttacttgtcctggcgggagagaatgtcttcaaggatcaaaaatacgccaatgtgaatttccattattttcaatggaaggcctcggccgattcctaggaggtggagaccacactaggatgctgctttcttgggaagagacaggagagcggcctcatctctaccacagcacaggggtggacagcctaggactccaaggatgctggcttgttggctccctcccttcccaccctgcttacaggctttggctgctcagcgcttggacagcaccaggtgaccgtgacaggccaccttggcctttgggaactctgctccagctggtacatttctcacttggcctccctaatcacccctctcaccagaatcaggattcctgagggagaggcaccatggtcccctgagaataataaaatggtttctggacctccttgattacaccttaattttcaaaataaagtcagttattaaaggctagtaaaaa

//