GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 10:33:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001107042            1863 bp    mRNA    linear   ROD 17-DEC-2023
DEFINITION  Rattus norvegicus homeo box B3 (Hoxb3), mRNA.
ACCESSION   NM_001107042 XM_001081342 XM_220893
VERSION     NM_001107042.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1863)
  AUTHORS   Jia X, Yang S, Wang X, Ruan J and Huang W.
  TITLE     HOXB3 promotes trophoblast cell proliferation, invasion, and
            migration to alleviate preeclampsia via mediating the
            Notch/Wnt/beta-catenin pathway
  JOURNAL   Eur J Pharmacol 960, 176015 (2023)
   PUBMED   37652291
  REMARK    GeneRIF: HOXB3 promotes trophoblast cell proliferation, invasion,
            and migration to alleviate preeclampsia via mediating the
            Notch/Wnt/beta-catenin pathway.
REFERENCE   2  (bases 1 to 1863)
  AUTHORS   Nagamachi A, Matsui H, Asou H, Ozaki Y, Aki D, Kanai A, Takubo K,
            Suda T, Nakamura T, Wolff L, Honda H and Inaba T.
  TITLE     Haploinsufficiency of SAMD9L, an endosome fusion facilitator,
            causes myeloid malignancies in mice mimicking human diseases with
            monosomy 7
  JOURNAL   Cancer Cell 24 (3), 305-317 (2013)
   PUBMED   24029230
REFERENCE   3  (bases 1 to 1863)
  AUTHORS   Wong EY, Wang XA, Mak SS, Sae-Pang JJ, Ling KW, Fritzsch B and Sham
            MH.
  TITLE     Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain
            patterning
  JOURNAL   Dev Biol 352 (2), 382-392 (2011)
   PUBMED   21320481
REFERENCE   4  (bases 1 to 1863)
  AUTHORS   Chung N, Jee BK, Chae SW, Jeon YW, Lee KH and Rha HK.
  TITLE     HOX gene analysis of endothelial cell differentiation in human bone
            marrow-derived mesenchymal stem cells
  JOURNAL   Mol Biol Rep 36 (2), 227-235 (2009)
   PUBMED   17972163
REFERENCE   5  (bases 1 to 1863)
  AUTHORS   Magnusson M, Brun AC, Lawrence HJ and Karlsson S.
  TITLE     Hoxa9/hoxb3/hoxb4 compound null mice display severe hematopoietic
            defects
  JOURNAL   Exp Hematol 35 (9), 1421-1428 (2007)
   PUBMED   17761289
REFERENCE   6  (bases 1 to 1863)
  AUTHORS   Medina-Martinez O, Bradley A and Ramirez-Solis R.
  TITLE     A large targeted deletion of Hoxb1-Hoxb9 produces a series of
            single-segment anterior homeotic transformations
  JOURNAL   Dev Biol 222 (1), 71-83 (2000)
   PUBMED   10885747
REFERENCE   7  (bases 1 to 1863)
  AUTHORS   Guazzi S, Pintonello ML, Vigano A and Boncinelli E.
  TITLE     Regulatory interactions between the human HOXB1, HOXB2, and HOXB3
            proteins and the upstream sequence of the Otx2 gene in embryonal
            carcinoma cells
  JOURNAL   J Biol Chem 273 (18), 11092-11099 (1998)
   PUBMED   9556594
REFERENCE   8  (bases 1 to 1863)
  AUTHORS   Manley NR and Capecchi MR.
  TITLE     Hox group 3 paralogs regulate the development and migration of the
            thymus, thyroid, and parathyroid glands
  JOURNAL   Dev Biol 195 (1), 1-15 (1998)
   PUBMED   9520319
REFERENCE   9  (bases 1 to 1863)
  AUTHORS   Manley NR and Capecchi MR.
  TITLE     Hox group 3 paralogous genes act synergistically in the formation
            of somitic and neural crest-derived structures
  JOURNAL   Dev Biol 192 (2), 274-288 (1997)
   PUBMED   9441667
REFERENCE   10 (bases 1 to 1863)
  AUTHORS   Guazzi S, Lonigro R, Pintonello L, Boncinelli E, Di Lauro R and
            Mavilio F.
  TITLE     The thyroid transcription factor-1 gene is a candidate target for
            regulation by Hox proteins
  JOURNAL   EMBO J 13 (14), 3339-3347 (1994)
   PUBMED   7913891
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473948.1.
            
            On or before Oct 4, 2007 this sequence version replaced
            XM_001081342.1, XM_220893.4.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, longest protein
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1863
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q26"
     gene            1..1863
                     /gene="Hoxb3"
                     /note="homeo box B3"
                     /db_xref="GeneID:303488"
                     /db_xref="RGD:1310780"
     exon            1..913
                     /gene="Hoxb3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    412..414
                     /gene="Hoxb3"
                     /note="upstream in-frame stop codon"
     CDS             466..1755
                     /gene="Hoxb3"
                     /codon_start=1
                     /product="homeobox protein Hox-B3"
                     /protein_id="NP_001100512.1"
                     /db_xref="GeneID:303488"
                     /db_xref="RGD:1310780"
                     /translation="
MQKATYYDNTAAALFGGYSSYPGSNGFGYDGPPQPPFQAATHLEGDYQRSACSLQSLGNAAPHAKSKELNGSCMRPGLAPEPLPAPPGSPPPSAAPTSTTSNSNNGGGPSKSGPPKCGASSNSTLTKQIFPWMKESRQTSKLKNSSPGTAEGCGGGGGGGGGGGSSSGGGGSGGGGGDKSPPGSAASKRARTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLSERQIKIWFQNRRMKYKKDQKAKGLASSSGGPSPAGSPPQPMQSTAGFMNALHSMTPSYDSPSPPAFSKGHQNAYALPSNYQPPLKGCGAPQKYPPTPAPEYESHVLQANGGAYGTPTMQGSPVYVGGGGYADPLPPPAGPSLYGLNHLSHHPSGNLDYNGAAPMAPGQHHGPCDPHPTYTDLSSHHAPPQGRIQEAPKLTHL"
     misc_feature    order(1027..1041,1045..1047,1096..1098,1114..1116,
                     1153..1155,1159..1164,1171..1176,1180..1188,1192..1197)
                     /gene="Hoxb3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(1033..1035,1042..1044,1162..1164,1171..1176,
                     1183..1185)
                     /gene="Hoxb3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1036..1194
                     /gene="Hoxb3"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    1558..1746
                     /gene="Hoxb3"
                     /note="Domain of unknown function (DUF4074); Region:
                     DUF4074; pfam13293"
                     /db_xref="CDD:433094"
     exon            914..1863
                     /gene="Hoxb3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tagtgcaggcgccagagagaggcggtggtccacgaggcagtggtattttattcctaagtattcaccaaaggagtacagtcttgattttgtagaaaatggaaatggaaatcggtgttttctttttccctttaaaattaaagttgaagcgagaagcatccatgtcaggttagatacttggtctcagcgcctgctgcagagatagtggcgaggggagaagaaaaagaaaacctattgatgtcagttccctttttagttcctaagatggattcgaggcccagtcctcttctccccctctgtctcttctctcgccccgcaggtcagccgcttggaacagacccgggaggaggggggcagaaaggggaggggggtccggcgtgtcacgtgacccccaggggtgccaatgtccggtcgtgagggtatcaggcccttgcaagttgccacccactgcccgggcctcgcccagcgatgcagaaagccacctactacgacaacaccgcagctgcgctcttcggaggctactcctcgtaccctggcagcaatggtttcggctacgacgggcctccccagcccccctttcaggccgctacacacctggagggtgactaccagcgctcagcgtgttccctgcagtccctgggcaatgccgccccacatgccaagagcaaggagctcaacggcagctgcatgaggccaggcctggccccagagcccctgcccgcaccgccgggttcacccccacccagcgccgcacctaccagtaccactagcaacagcaataacgggggtgggcccagcaaaagcggcccccccaagtgcggtgccagctccaactccaccctcaccaaacagatattcccctggatgaaagagtcaaggcaaacgtccaagctgaaaaacagctccccgggcacagcagaaggttgtggtggcggcggcggcggcggtggcggcggcggtagtagcagcggcgggggcggcagcggcggcgggggaggggacaagagccccccggggtcggcggcgtccaagcgggcgcggacggcatacacaagcgcgcagctggttgagctggagaaggagttccacttcaaccgttatttgtgccggccgcgccgcgtcgagatggccaatctgctgaacctcagcgagcggcagatcaagatctggttccagaaccgccgcatgaagtacaagaaagaccagaaggccaaggggctggcctcgtcctccgggggtccctctccggccggaagccccccgcagcccatgcagtccacggccggcttcatgaacgccttacactccatgacccccagctacgacagcccgtccccaccagccttcagcaaaggccaccagaatgcctacgcgctgccttccaactatcagccccctctcaagggttgcggcgccccacagaagtaccccccgaccccggcgccggagtatgagtcccacgtcctccaagccaacgggggagcctacgggacgcccaccatgcagggcagtcctgtctatgtgggcgggggtggctacgcggatccgttgccgccccctgccggcccctccctctacggcctcaatcacctttcccaccacccctcggggaacctggactacaacggggcggcccctatggcccccggccagcatcacggaccctgtgaccctcaccccacgtacacagacctctcctctcaccacgcaccgcctcagggtagaatccaagaagcgcccaaactgacacacctgtgatgggaggggcgggctggggaggggggggtgaggttaagggacagggagaccgtggaactgggggatgggcgcggtttggagtcctgaaaaaggtatgtgttggggttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]