GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-13 00:08:33, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XR_867250                612 bp    RNA     linear   ROD 07-FEB-2024
DEFINITION  PREDICTED: Mus musculus predicted gene, 40044 (Gm40044), ncRNA.
ACCESSION   XR_867250
VERSION     XR_867250.1
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000069.7) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/01/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..612
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="3"
     gene            1..612
                     /gene="Gm40044"
                     /note="predicted gene, 40044; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 3 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105244437"
                     /db_xref="MGI:MGI:5622929"
     ncRNA           1..612
                     /ncRNA_class="lncRNA"
                     /gene="Gm40044"
                     /product="predicted gene, 40044"
                     /db_xref="GeneID:105244437"
                     /db_xref="MGI:MGI:5622929"
ORIGIN      
ttcaaaaatacattcaaggactggggaagtagatgagaaggcagactccttgcttctctaatgtgttgcaaggctaagtttgacccatagcagcacacacacattcacatacaattcagcaactatttgcttagacagaatagacaaatattatataatcccctgttagtgtattccataaacgaattgaacaaaatttgtctagtagaggagacattgcataaatacaatatttttgttgtgttttatcgcaaacggttttatttacccggtaagtgcaggatcaagggatggagaagatatcatggaagcagaagaggagtcctaattgactggagaggcttcatgtactgttgtctaatcttttttgttggttgagaagggtcttgctctgtagcttttggctggcctggaactcatgatgtagaccaagttgaccttgaaggcagaaagacctgcctgtctctgcttcccaaatgcttcagtgaaaggtcagtgaagttgcaagactcacaagcgttgcacagccagctgtaccagcaagccaagccctgtttctgtcactccatggagtcctgtttataccctctgtggtggctattcctggttgtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]