LOCUS       XM_036152810             789 bp    mRNA    linear   ROD 07-FEB-2024
DEFINITION  PREDICTED: Mus musculus ribosomal protein S5 (Rps5), transcript
            variant X1, mRNA.
ACCESSION   XM_036152810
VERSION     XM_036152810.1
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000073.7) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/01/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..789
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="7"
     gene            1..789
                     /gene="Rps5"
                     /note="ribosomal protein S5; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     mRNA, 193 ESTs, 18211 long SRA reads, 500 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 56 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
     CDS             129..743
                     /gene="Rps5"
                     /codon_start=1
                     /product="small ribosomal subunit protein uS7 isoform X1"
                     /protein_id="XP_036008703.1"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
                     /translation="

MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"

     misc_feature    180..740
                     /gene="Rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(180..182,267..275,279..290,387..389,399..401)
                     /gene="Rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(279..281,285..287,297..308,315..317,339..341,
                     348..350,354..368,378..392,399..401,519..527,531..533,
                     561..563,582..584,603..605,612..614,630..635)
                     /gene="Rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(411..413,420..425,432..434,630..632,636..641)
                     /gene="Rps5"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(516..518,525..527,531..533,738..740)
                     /gene="Rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
ORIGIN      

gcgctagtccgctgcgcgcggcctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggtgaggctgcggagggacacggagttcagaagaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata

//