ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-28 02:28:50, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_017312234 1288 bp mRNA linear ROD 07-FEB-2024
DEFINITION PREDICTED: Mus musculus tripartite motif-containing 5 (Trim5),
transcript variant X3, mRNA.
ACCESSION XM_017312234
VERSION XM_017312234.3
DBLINK BioProject: PRJNA169
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000073.7) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
On Sep 21, 2020 this sequence version replaced XM_017312234.2.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001635.27-RS_2024_02
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 02/01/2024
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1288
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6J"
/db_xref="taxon:10090"
/chromosome="7"
gene 1..1288
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/note="tripartite motif-containing 5; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 1 EST,
1 long SRA read, 10 Proteins, and 100% coverage of the
annotated genomic feature by RNAseq alignments, including
7 samples with support for all annotated introns"
/db_xref="GeneID:667823"
/db_xref="MGI:MGI:3646853"
CDS 215..1006
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/codon_start=1
/product="tripartite motif-containing 5 isoform X3"
/protein_id="XP_017167723.1"
/db_xref="GeneID:667823"
/db_xref="MGI:MGI:3646853"
/translation="
MASQFMKNLKEEVTCPVCLNLMVKPVSADCGHTFCQGCITLYFESIKCDKEMFSCPVCRLSYQSSNLRPNLHVANIVERLKEFKPSPEEEQKVFNCARHGEKLQLFCRKDMMAICWLCERSQEHRGHKTALIEEVAREYKEQLQVVLQRLMADKKEFENWKDELQKDRTYWENQIQKDVENVQSEFKRMRDIIDSEEKNELQKLRQEKEDILNNLAESESEHAQQSKLLEDFISDVEHQLQCSDIEILQGVENIIKRGQAPWF"
misc_feature 236..448
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/note="RING finger (Really Interesting New Gene) domain
and U-box domain superfamily; Region: RING_Ubox; cl17238"
/db_xref="CDD:473075"
misc_feature order(257..259,266..268,302..304,308..310,317..319,
326..328,377..379,386..388)
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/note="cross-brace motif; other site"
/db_xref="CDD:438253"
misc_feature 500..613
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/note="B-box-type 2 zinc finger found in tripartite
motif-containing proteins, TRIM5, TRIM6, TRIM22, TRIM34,
TRIM38 and similar proteins; Region: Bbox2_TRIM5-like;
cd19761"
/db_xref="CDD:380819"
misc_feature <563..>931
/gene="Trim5"
/gene_synonym="EG667823; Gm8833"
/note="RecF/RecN/SMC N terminal domain; Region: SMC_N;
cl47134"
/db_xref="CDD:481474"
ORIGIN
atgctgatatgagggtaacttcctcagtcagtggggttctgcaggcttatgcaaaggcatctcattggtctgtagagttgtggtttctgtttcatttccagagctcaaactttcctttctctagattttagccggaaataccttgaagttctggattggcacctgagcagaagtgcaaggagtccggacagtcatacacaggatcacagcaactatggcttcacaattcatgaagaatttaaaggaggaggtgacctgtcctgtctgtctgaacctgatggtgaaacctgtgagtgcagattgtggtcacaccttctgccaaggctgcatcacgttgtactttgaatccatcaaatgtgataaggaaatgttcagttgccctgtgtgccgacttagttaccagtctagcaatctgaggcctaatctacatgtggccaacatagtagagaggctcaaagagttcaagcccagcccagaagaggagcagaaagtgtttaactgtgcaagacatggagagaaactccagctcttctgtaggaaggacatgatggccatctgctggctttgtgagcgatctcaggagcaccggggccacaaaacagctctcattgaagaggtggcccgggagtacaaggagcagctgcaggtagttctgcaaaggctgatggcagataagaaagaatttgaaaactggaaagatgaacttcagaaggatagaacttactgggagaatcaaatacagaaagatgtggagaatgttcagtcagagtttaaacgaatgagggatatcatagactcagaggagaagaatgaattgcagaagctgaggcaagagaaggaagacattctcaacaacctggcagagtctgaaagtgagcatgctcagcagagcaagttgctagaagacttcatctcagatgtggaacatcagttacagtgctcagacatagaaatactacagggtgtggagaacatcataaaacgagggcaagcaccatggttctgagaatgtaagaccttcccaacacttcgttgaatgtaatttgaaggagacatgattgtattcatgtgactggcatctctctacctcttcagcttcctcgaaagagctcaaggtcatctgtggtggaaaggagaggaatctgtgggagttgggggtcactgggagggattgcaggtcaattgctttttatccctaggagtcttactttttcgatgaagaagcccaaaaccatcgccagggaacaaagaaagttccgagcccctgacctgcaaggcatgctgcaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]