ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-28 02:28:43, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_011241512 1435 bp mRNA linear ROD 07-FEB-2024
DEFINITION PREDICTED: Mus musculus transmembrane protein 40 (Tmem40),
transcript variant X4, mRNA.
ACCESSION XM_011241512
VERSION XM_011241512.4
DBLINK BioProject: PRJNA169
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000072.7) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
On Sep 21, 2020 this sequence version replaced XM_011241512.3.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001635.27-RS_2024_02
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 02/01/2024
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1435
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6J"
/db_xref="taxon:10090"
/chromosome="6"
gene 1..1435
/gene="Tmem40"
/gene_synonym="9030407H20Rik"
/note="transmembrane protein 40; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 9
ESTs, 24 long SRA reads, 1 Protein, and 100% coverage of
the annotated genomic feature by RNAseq alignments,
including 17 samples with support for all annotated
introns"
/db_xref="GeneID:94346"
/db_xref="MGI:MGI:2137870"
CDS 233..901
/gene="Tmem40"
/gene_synonym="9030407H20Rik"
/codon_start=1
/product="transmembrane protein 40 isoform X3"
/protein_id="XP_011239814.1"
/db_xref="GeneID:94346"
/db_xref="MGI:MGI:2137870"
/translation="
MVAPPSAVTVPWPLLPQPGHIHSQHTAHLAAHMSPGTPGKVMEASGSSSQSQDSGGVHRETEDHYSSDEDQPSRGPRKHRRRPRRDSLRGADHGELEVLKDELQLCGGAAGEMVPTGESGLRRRGSGSAEGEVEASQLRRLNIKKDDEFFHFVLLCFAIGALLVCYHYYADWFMSLGVGLLTFASLETIGIYFGLVYRIHSVLQGFIPLLQKFRLPGFRRTN"
misc_feature 536..895
/gene="Tmem40"
/gene_synonym="9030407H20Rik"
/note="Transmembrane protein 40 family; Region: TMEM40;
pfam15817"
/db_xref="CDD:464892"
ORIGIN
cttcctggagtttgtcacgacctggggaggtccaccatggttgccactcggggcttcaggttttagtgtgatcctggggtctgtgggggtgtgtttgccaccatcagcccctcttaggatgctgggggaagaggcaagtcagacaggaaggcctgggggctgatagcaccacaggaaggaatgccaatgccacagcaccagggtgagccagcgggggcccaggggcaacgtcatggttgccccgccctctgctgtcacggtgccatggcctctccttccccagcccggccacattcacagtcaacacacagctcaccttgcagctcacatgagcccagggactccagggaaagtcatggaggcttcaggatcttcttcccagtctcaagacagtggtggagtccacagggaaacggaagatcactacagcagcgatgaggaccagccctccagaggtcccaggaaacacagaaggaggccccgcagggacagcttgcgtggtgccgaccatggggaactggaagtgctaaaggacgagcttcagctctgcggaggtgctgctggggaaatggtgcctactggggagtcaggactccgaaggagaggttccggctcagcggagggagaagtggaggcctctcagttaagaagactgaacataaagaaggatgatgagtttttccattttgtccttctctgctttgccatcggagccttgctggtgtgttaccactactatgcagactggttcatgtccctcggggtcggcctgctcacctttgcttctctcgagaccattggcatctatttcgggctcgtgtaccggatccacagcgtgcttcagggcttcatccccctccttcagaagttccggctgccagggttcaggagaactaactgagatcactgcctgacagcagctgagccagtccccaatgtgaccactgtaaccactgccatgcctgagcccagaagacagaacgacgcgctggaagacaccagaaggccacacaataaagagctctttccttccacgtgatctgagtgtcggcaccagtgggcaggctcttgctctgcagattaacacgcagtctccgtggggaagagaagaggggatagcgtcgggtcagcacggaggagctgggatgccattgctcataggtcaacatgaatcctgggttctgcaggctggcatctgcgggcctgggtctctctggtgtcctcaggccatgcccaggagctcacagttcctgcagagccttcttgggacagccattctgaggcagggagctaccaggctgggttcccaggggaacttgttgcaggtaagacgctggggaccaaagctgcggacccatcatagctgaccaaccctgttgcccttggactcctaaaatccaaataaattttctgttccttgtgcttaaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]