2024-07-01 23:12:28, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NR_189663 2274 bp RNA linear ROD 05-DEC-2023 DEFINITION Mus musculus solute carrier family 35 (UDP-galactose transporter), member A2 (Slc35a2), transcript variant 10, non-coding RNA. ACCESSION NR_189663 VERSION NR_189663.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2274) AUTHORS Cheng H, Wang S, Gao D, Yu K, Chen H, Huang Y, Li M, Zhang J and Guo K. TITLE Nucleotide sugar transporter SLC35A2 is involved in promoting hepatocellular carcinoma metastasis by regulating cellular glycosylation JOURNAL Cell Oncol (Dordr) 46 (2), 283-297 (2023) PUBMED 36454514 REMARK GeneRIF: Nucleotide sugar transporter SLC35A2 is involved in promoting hepatocellular carcinoma metastasis by regulating cellular glycosylation. REFERENCE 2 (bases 1 to 2274) AUTHORS Hayashi Y, Ito Y, Yanagiba Y, Kamijima M, Naito H and Nakajima T. TITLE Differences in metabolite burden of di(2-ethylhexyl)phthalate in pregnant and postpartum dams and their offspring in relation to drug-metabolizing enzymes in mice JOURNAL Arch Toxicol 86 (4), 563-569 (2012) PUBMED 22159897 REMARK GeneRIF: DEHP exposure did not influence lipase activity, whereas it slightly enhanced UGT activity and exclusively increased CYP4A14 levels in pregnant and/or postpartum dams. REFERENCE 3 (bases 1 to 2274) AUTHORS Oelmann S, Stanley P and Gerardy-Schahn R. TITLE Point mutations identified in Lec8 Chinese hamster ovary glycosylation mutants that inactivate both the UDP-galactose and CMP-sialic acid transporters JOURNAL J Biol Chem 276 (28), 26291-26300 (2001) PUBMED 11319223 REFERENCE 4 (bases 1 to 2274) AUTHORS Means GD, Toy DY, Baum PR and Derry JM. TITLE A transcript map of a 2-Mb BAC contig in the proximal portion of the mouse X chromosome and regional mapping of the scurfy mutation JOURNAL Genomics 65 (3), 213-223 (2000) PUBMED 10857745 REFERENCE 5 (bases 1 to 2274) AUTHORS Ishida N, Yoshioka S, Iida M, Sudo K, Miura N, Aoki K and Kawakita M. TITLE Indispensability of transmembrane domains of Golgi UDP-galactose transporter as revealed by analysis of genetic defects in UDP-galactose transporter-deficient murine had-1 mutant cell lines and construction of deletion mutants JOURNAL J Biochem 126 (6), 1107-1117 (1999) PUBMED 10578063 REFERENCE 6 (bases 1 to 2274) AUTHORS Ishida N, Miura N, Yoshioka S and Kawakita M. TITLE Molecular cloning and characterization of a novel isoform of the human UDP-galactose transporter, and of related complementary DNAs belonging to the nucleotide-sugar transporter gene family JOURNAL J Biochem 120 (6), 1074-1078 (1996) PUBMED 9010752 REFERENCE 7 (bases 1 to 2274) AUTHORS Lennon G, Auffray C, Polymeropoulos M and Soares MB. TITLE The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression JOURNAL Genomics 33 (1), 151-152 (1996) PUBMED 8617505 REFERENCE 8 (bases 1 to 2274) AUTHORS Hara T, Yamauchi M, Takahashi E, Hoshino M, Aoki K, Ayusawa D and Kawakita M. TITLE The UDP-galactose translocator gene is mapped to band Xp11.23-p11.22 containing the Wiskott-Aldrich syndrome locus JOURNAL Somat Cell Mol Genet 19 (6), 571-575 (1993) PUBMED 8128316 REFERENCE 9 (bases 1 to 2274) AUTHORS Hara T, Hattori S and Kawakita M. TITLE Isolation and characterization of mouse FM3A cell mutants which are devoid of Newcastle disease virus receptors JOURNAL J Virol 63 (1), 182-188 (1989) PUBMED 2535724 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL671978.2. ##Evidence-Data-START## Transcript exon combination :: SRR17253012.7581928.1, SRR13422586.114305.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849377 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-101 AL671978.2 40630-40730 102-576 AL671978.2 42046-42520 577-728 AL671978.2 45909-46060 729-2004 AL671978.2 48437-49712 2005-2274 AL671978.2 50488-50757 FEATURES Location/Qualifiers source 1..2274 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="X" /map="X 3.56 cM" gene 1..2274 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /note="solute carrier family 35 (UDP-galactose transporter), member A2" /db_xref="GeneID:22232" /db_xref="MGI:MGI:1345297" misc_RNA 1..2274 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /product="solute carrier family 35 (UDP-galactose transporter), member A2, transcript variant 10" /db_xref="GeneID:22232" /db_xref="MGI:MGI:1345297" exon 1..101 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="alignment:Splign:2.1.0" misc_feature 11..337 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_001083937.1" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" exon 102..576 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="alignment:Splign:2.1.0" exon 577..728 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="alignment:Splign:2.1.0" exon 729..2004 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="alignment:Splign:2.1.0" exon 2005..2274 /gene="Slc35a2" /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT" /inference="alignment:Splign:2.1.0" ORIGIN
agatgccaacatggcagcggttggggttggtggatctaccgctgcggccggggctggggctgtgtcctcgggcgcgttggaacctgggtccactacagcggctcaccggcgcctcaagtatatatccttagctgtgctggtggtccagaatgcctccctcatcctcagcatccgctacgctcgcacactgcctggggaccgcttctttgccaccactgctgtggtcatggctgaagtgctcaaaggtctcacctgtctcctgctgctcttcgcacaaaagaggggtatgagtcaccaatggggttggttggtgggactccctaagttaagggtgtaagtacccctgggaggtttgctgggagagtagactggtgtgtctgaggatgcttgaggagtaggtaggagcttttaagcttcctgaccactgcagctatgtgaagttgcatctccacgtggatattccttatacctgagaactacaccagtgagattgactgcccacaggcaacagaagacccacggtgattgaaaggtagaggcatgaagatcaggagctcaagataacataagttcaaggtaatgtgaagcacctggtcctcttcctccatgaggctgtcctggtccaatatgtggacacactcaagcttgcggtgccctctctcatctataccttgcagaataacctccagtatgttgccatcagcaacctgccagctgccactttccaggtgacatatcagctgaagatcctgactacagcgctcttctctgtgctcatgttgaatcgcagcctctcacgcctgcagtgggcctctctgctgctgctcttcactggtgtcgccattgtccaggcacagcaagctggtgggagtggcccacggccactggatcagaacccgggggcgggcttagcggcagttgtggcctcctgtctctcctcaggcttcgctggggtctactttgagaagatcctcaaaggcagctcaggttctgtgtggcttcgtaacctacagctcggcctctttggcacagcgctgggcctggtggggctctggtgggctgagggcaccgccgtggccagtcaaggcttcttctttgggtacacacctgctgtctggggtgtagtactaaaccaagcctttggtgggcttctggtggctgttgttgtcaagtatgctgacaacatcctcaagggctttgccacctccctgtctattgtgctgtccactgttgcctccattcgcctctttggcttccacctggacccattatttgccctgggcgctgggctcgtcattggtgctgtctacctctacagccttccccgaggtgcagtcaaagccatagcctcggcctcggcctctgggccctgcattcaccagcagcctcctgggcagccaccaccaccgcagctgtcttctcgaggagacctcaccacggagccctttctgccaaagtcagtgctggtcaagtgagagctggtggtggttgggggaacagggcagggggttgggttggagggggttgggcttctgcaggtccaaaaagttgttgccagggcctggcttttgtgggttggaggtttattttctcccataattctagagggatatggaactagggctgaatgtcacatgaacgcttcctgatagatggactctcctctcctggaggagctttttagagctgcttcctctgccttgggctaacctctttgggaacagggttggggtactgctattccaggcctttcccccatgaccctgtgctggagatgtcctgtctcgcatgcctgggacagtccctcccagccatcctgcagactggataaaagccctgcagctctccaataacgactaatgactcctcgtggggttcatttcctattgtatgaggtcttctctcctgcaccatcaccctggatcatgacaacagcgtggtctctgctgtggctttggggcagtttccccggtacagagacccttgaagagcaatcagcctgttgttgctcaccaaggtgaaggggtcgtagctgctggacttgaagatgctggcctgtcttcgttctcccttcttgccctggcccaactgggactaaactcttatcagtattaggggtagggtgaggtagacacgggaactccctgtccttaccaacccctgccccacatagggctgacatgactaacctctgttaatgggcccacctctactcctgctatctttacagtatttcttaggtgagtttctgcaaataaaatgttttgcaccttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]