GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-19 15:22:36, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_155303                685 bp    RNA     linear   ROD 15-JAN-2024
DEFINITION  Mus musculus homeobox B3 and homeobox B2, opposite strand
            (Hoxb3os), long non-coding RNA.
ACCESSION   NR_155303
VERSION     NR_155303.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 685)
  AUTHORS   Weisser I, Eckberg K, D'Amico S, Buttram D and Aboudehen K.
  TITLE     Ablation of Long Noncoding RNA Hoxb3os Exacerbates Cystogenesis in
            Mouse Polycystic Kidney Disease
  JOURNAL   J Am Soc Nephrol 35 (1), 41-55 (2024)
   PUBMED   37953472
  REMARK    GeneRIF: Ablation of Long Noncoding RNA Hoxb3os Exacerbates
            Cystogenesis in Mouse Polycystic Kidney Disease.
REFERENCE   2  (bases 1 to 685)
  AUTHORS   Peng G, Suo S, Cui G, Yu F, Wang R, Chen J, Chen S, Liu Z, Chen G,
            Qian Y, Tam PPL, Han JJ and Jing N.
  TITLE     Molecular architecture of lineage allocation and tissue
            organization in early mouse embryo
  JOURNAL   Nature 572 (7770), 528-532 (2019)
   PUBMED   31391582
  REMARK    Erratum:[Nature. 2020 Jan;577(7791):E6. PMID: 31896818]
REFERENCE   3  (bases 1 to 685)
  AUTHORS   Aboudehen K, Farahani S, Kanchwala M, Chan SC, Avdulov S, Mickelson
            A, Lee D, Gearhart MD, Patel V, Xing C and Igarashi P.
  TITLE     Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant
            polycystic kidney disease and regulates mTOR signaling
  JOURNAL   J Biol Chem 293 (24), 9388-9398 (2018)
   PUBMED   29716997
  REMARK    GeneRIF: These findings identify Hoxb3os as a novel lncRNA that is
            down-regulated in Autosomal dominant polycystic kidney disease and
            regulates mTOR signaling and mitochondrial respiration.
REFERENCE   4  (bases 1 to 685)
  AUTHORS   Harrow JL, Steward CA, Frankish A, Gilbert JG, Gonzalez JM,
            Loveland JE, Mudge J, Sheppard D, Thomas M, Trevanion S and Wilming
            LG.
  TITLE     The Vertebrate Genome Annotation browser 10 years on
  JOURNAL   Nucleic Acids Res 42 (Database issue), D771-D779 (2014)
   PUBMED   24316575
REFERENCE   5  (bases 1 to 685)
  AUTHORS   Chan KT, Qi J and Sham MH.
  TITLE     Multiple coding and non-coding RNAs in the Hoxb3 locus and their
            spatial expression patterns during mouse embryogenesis
  JOURNAL   Biochem Biophys Res Commun 398 (2), 153-159 (2010)
   PUBMED   20515659
REFERENCE   6  (bases 1 to 685)
  AUTHORS   Studer M, Lumsden A, Ariza-McNaughton L, Bradley A and Krumlauf R.
  TITLE     Altered segmental identity and abnormal migration of motor neurons
            in mice lacking Hoxb-1
  JOURNAL   Nature 384 (6610), 630-634 (1996)
   PUBMED   8967950
REFERENCE   7  (bases 1 to 685)
  AUTHORS   Manley NR and Capecchi MR.
  TITLE     The role of Hoxa-3 in mouse thymus and thyroid development
  JOURNAL   Development 121 (7), 1989-2003 (1995)
   PUBMED   7635047
REFERENCE   8  (bases 1 to 685)
  AUTHORS   Gendron-Maguire M, Mallo M, Zhang M and Gridley T.
  TITLE     Hoxa-2 mutant mice exhibit homeotic transformation of skeletal
            elements derived from cranial neural crest
  JOURNAL   Cell 75 (7), 1317-1331 (1993)
   PUBMED   7903600
REFERENCE   9  (bases 1 to 685)
  AUTHORS   Swiatek PJ and Gridley T.
  TITLE     Perinatal lethality and defects in hindbrain development in mice
            homozygous for a targeted mutation of the zinc finger gene Krox20
  JOURNAL   Genes Dev 7 (11), 2071-2084 (1993)
   PUBMED   8224839
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL606824.13.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BE847805.1, BE687976.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849382, SAMN00849385
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-335               AL606824.13        48100-48434         c
            336-430             AL606824.13        43334-43428         c
            431-493             AL606824.13        41867-41929         c
            494-685             AL606824.13        38074-38265         c
FEATURES             Location/Qualifiers
     source          1..685
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 59.85 cM"
     gene            1..685
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /note="homeobox B3 and homeobox B2, opposite strand"
                     /db_xref="GeneID:102632302"
                     /db_xref="MGI:MGI:103211"
     ncRNA           1..685
                     /ncRNA_class="lncRNA"
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /product="homeobox B3 and homeobox B2, opposite strand"
                     /db_xref="GeneID:102632302"
                     /db_xref="MGI:MGI:103211"
     exon            1..335
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /inference="alignment:Splign:2.1.0"
     exon            336..430
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /inference="alignment:Splign:2.1.0"
     exon            431..493
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /inference="alignment:Splign:2.1.0"
     exon            494..685
                     /gene="Hoxb3os"
                     /gene_synonym="Gm11530; Hoxb3s"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
attgtgcagccggggctcgatgcgcccacactctccagggtggtggcaggcagcgctgacggcggtgcgccccggggtccctgcgcggcctcggcggggtggaagcaggcttcccgcagccggtgagtcgcgacgtcgcccgggctgaccgtgggttcctcggctggctctcccgcgtcgtcctgggcgctcggcccgcctggttctccctcgggcggctctcgatgctgcgtctgccgcttgtgtttcatgcgtcggttctggaaccagactttgacctgcctttcggtgaggtccagcaaggcagcgatctcgacgcgacgcggccggcacagacccaatgatggttgggcttcgggtcacgtgacagcctcattgtagctccggaagagaacgtgaagtttaggttgcctggaagaagcagtaataaggagactgaaagggagaacaaaaaaaatcaagattttggggaaattacccacagagatgcaagggaaaaagaaaaaggaaaaggaaaaactgtgcatctgctggaatctcttttctactgagatgggggaaattatccaggatgagaaagactcacaaaacaatttgaacactattcttctctggattcaaaggggaggctgtttactgaggttcccaacagcaaaaaataaaataaaataaaattatggtcact
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]