LOCUS       NR_130324                121 bp    RNA     linear   ROD 18-OCT-2021
DEFINITION  Mus musculus microRNA 669f (Mir669f), microRNA.
ACCESSION   NR_130324
VERSION     NR_130324.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 121)
  AUTHORS   Ghosh T, Aprea J, Nardelli J, Engel H, Selinger C, Mombereau C,
            Lemonnier T, Moutkine I, Schwendimann L, Dori M, Irinopoulou T,
            Henrion-Caude A, Benecke AG, Arnold SJ, Gressens P, Calegari F and
            Groszer M.
  TITLE     MicroRNAs establish robustness and adaptability of a critical gene
            network to regulate progenitor fate decisions during cortical
            neurogenesis
  JOURNAL   Cell Rep 7 (6), 1779-1788 (2014)
   PUBMED   24931612
REFERENCE   2  (bases 1 to 121)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   3  (bases 1 to 121)
  AUTHORS   Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G and
            Adler H.
  TITLE     Identification and analysis of expression of novel microRNAs of
            murine gammaherpesvirus 68
  JOURNAL   J Virol 84 (19), 10266-10275 (2010)
   PUBMED   20668074
REFERENCE   4  (bases 1 to 121)
  AUTHORS   Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA,
            Rusyn I and Beland FA.
  TITLE     Difference in expression of hepatic microRNAs miR-29c, miR-34a,
            miR-155, and miR-200b is associated with strain-specific
            susceptibility to dietary nonalcoholic steatohepatitis in mice
  JOURNAL   Lab Invest 90 (10), 1437-1446 (2010)
   PUBMED   20548288
REFERENCE   5  (bases 1 to 121)
  AUTHORS   Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
            Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
            Nusbaum C and Bartel DP.
  TITLE     Mammalian microRNAs: experimental evaluation of novel and
            previously annotated genes
  JOURNAL   Genes Dev 24 (10), 992-1009 (2010)
   PUBMED   20413612
REFERENCE   6  (bases 1 to 121)
  AUTHORS   Calabrese JM, Seila AC, Yeo GW and Sharp PA.
  TITLE     RNA sequence analysis defines Dicer's role in mouse embryonic stem
            cells
  JOURNAL   Proc Natl Acad Sci U S A 104 (46), 18097-18102 (2007)
   PUBMED   17989215
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2007 Dec 26;104(52):21021]
REFERENCE   7  (bases 1 to 121)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL772216.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR7652917.943261.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-121               AL772216.15        43263-43383
FEATURES             Location/Qualifiers
     source          1..121
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 8.22 cM"
     gene            1..121
                     /gene="Mir669f"
                     /gene_synonym="Mirn669f; mmu-mir-669f"
                     /note="microRNA 669f"
                     /db_xref="GeneID:100316667"
                     /db_xref="MGI:MGI:3783384"
                     /db_xref="miRBase:MI0006287"
     precursor_RNA   1..121
                     /gene="Mir669f"
                     /gene_synonym="Mirn669f; mmu-mir-669f"
                     /product="microRNA 669f"
                     /db_xref="GeneID:100316667"
                     /db_xref="MGI:MGI:3783384"
                     /db_xref="miRBase:MI0006287"
     exon            1..121
                     /gene="Mir669f"
                     /gene_synonym="Mirn669f; mmu-mir-669f"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           20..43
                     /ncRNA_class="miRNA"
                     /gene="Mir669f"
                     /gene_synonym="Mirn669f; mmu-mir-669f"
                     /product="mmu-miR-669f-5p"
                     /db_xref="miRBase:MIMAT0017327"
                     /db_xref="GeneID:100316667"
                     /db_xref="MGI:MGI:3783384"
                     /db_xref="miRBase:MI0006287"
     ncRNA           57..79
                     /ncRNA_class="miRNA"
                     /gene="Mir669f"
                     /gene_synonym="Mirn669f; mmu-mir-669f"
                     /product="mmu-miR-669f-3p"
                     /db_xref="miRBase:MIMAT0005839"
                     /db_xref="GeneID:100316667"
                     /db_xref="MGI:MGI:3783384"
                     /db_xref="miRBase:MI0006287"
ORIGIN      

tgtatgtgcctgtgtgtatagttgtgtgtgcatgtgcatgtgtgtatatgaatatacatatacatacacacacacgtataaacgcaagcacaaacacacacagaggaatggcactcgttga

//