ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-28 07:02:59, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_039559 64 bp RNA linear ROD 21-AUG-2023
DEFINITION Mus musculus microRNA 5100 (Mir5100), microRNA.
ACCESSION NR_039559
VERSION NR_039559.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 64)
AUTHORS Mierzejewski B, Grabowska I, Michalska Z, Zdunczyk K, Zareba F,
Irhashava A, Chrzaszcz M, Patrycy M, Streminska W, Janczyk-Ilach K,
Koblowska M, Iwanicka-Nowicka R, Gromadka A, Kowalski K, Ciemerych
MA and Brzoska E.
TITLE SDF-1 and NOTCH signaling in myogenic cell differentiation: the
role of miRNA10a, 425, and 5100
JOURNAL Stem Cell Res Ther 14 (1), 204 (2023)
PUBMED 37582765
REMARK GeneRIF: SDF-1 and NOTCH signaling in myogenic cell
differentiation: the role of miRNA10a, 425, and 5100.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 64)
AUTHORS Aomatsu A, Kaneko S, Yanai K, Ishii H, Ito K, Hirai K, Ookawara S,
Kobayashi Y, Sanui M and Morishita Y.
TITLE MicroRNA expression profiling in acute kidney injury
JOURNAL Transl Res 244, 1-31 (2022)
PUBMED 34871811
REMARK GeneRIF: MicroRNA expression profiling in acute kidney injury.
REFERENCE 3 (bases 1 to 64)
AUTHORS Wang H, Cui Y, Luan J, Zhou X, Li C, Li H, Shi L and Han J.
TITLE MiR-5100 promotes osteogenic differentiation by targeting Tob2
JOURNAL J Bone Miner Metab 35 (6), 608-615 (2017)
PUBMED 27873073
REMARK GeneRIF: These results revealed a new molecular mechanism that
fine-tunes osteoblast differentiation through miR-5100/Tob2/osterix
networks.
REFERENCE 4 (bases 1 to 64)
AUTHORS Li,C.J., Cheng,P., Liang,M.K., Chen,Y.S., Lu,Q., Wang,J.Y.,
Xia,Z.Y., Zhou,H.D., Cao,X., Xie,H., Liao,E.Y. and Luo,X.H.
TITLE MicroRNA-188 regulates age-related switch between osteoblast and
adipocyte differentiation
JOURNAL J Clin Invest 125 (4), 1509-1522 (2015)
PUBMED 25751060
REFERENCE 5 (bases 1 to 64)
AUTHORS Polikepahad S and Corry DB.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 6 (bases 1 to 64)
AUTHORS Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison
EP, Hannon GJ, Green DR and Withoff S.
TITLE Ordered progression of stage-specific miRNA profiles in the mouse
B2 B-cell lineage
JOURNAL Blood 117 (20), 5340-5349 (2011)
PUBMED 21403133
REFERENCE 7 (bases 1 to 64)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 8 (bases 1 to 64)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL596215.7.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM611515.1, JF446399.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-64 AL596215.7 157986-158049 c
FEATURES Location/Qualifiers
source 1..64
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="11"
/map="11 37.81 cM"
gene 1..64
/gene="Mir5100"
/gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
/note="microRNA 5100"
/db_xref="GeneID:100628625"
/db_xref="MGI:MGI:4950420"
/db_xref="miRBase:MI0018008"
precursor_RNA 1..64
/gene="Mir5100"
/gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
/product="microRNA 5100"
/db_xref="GeneID:100628625"
/db_xref="MGI:MGI:4950420"
/db_xref="miRBase:MI0018008"
exon 1..64
/gene="Mir5100"
/gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
/inference="alignment:Splign:2.1.0"
ncRNA 36..56
/ncRNA_class="miRNA"
/gene="Mir5100"
/gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
/product="mmu-miR-5100"
/db_xref="miRBase:MIMAT0020607"
/db_xref="GeneID:100628625"
/db_xref="MGI:MGI:4950420"
/db_xref="miRBase:MI0018008"
ORIGIN
gtgggagggaggacttgggaactgaagagcagagttcgaatcccagcggtgcctcttcccgact
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]