GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-28 07:02:59, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_039559                 64 bp    RNA     linear   ROD 21-AUG-2023
DEFINITION  Mus musculus microRNA 5100 (Mir5100), microRNA.
ACCESSION   NR_039559
VERSION     NR_039559.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 64)
  AUTHORS   Mierzejewski B, Grabowska I, Michalska Z, Zdunczyk K, Zareba F,
            Irhashava A, Chrzaszcz M, Patrycy M, Streminska W, Janczyk-Ilach K,
            Koblowska M, Iwanicka-Nowicka R, Gromadka A, Kowalski K, Ciemerych
            MA and Brzoska E.
  TITLE     SDF-1 and NOTCH signaling in myogenic cell differentiation: the
            role of miRNA10a, 425, and 5100
  JOURNAL   Stem Cell Res Ther 14 (1), 204 (2023)
   PUBMED   37582765
  REMARK    GeneRIF: SDF-1 and NOTCH signaling in myogenic cell
            differentiation: the role of miRNA10a, 425, and 5100.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 64)
  AUTHORS   Aomatsu A, Kaneko S, Yanai K, Ishii H, Ito K, Hirai K, Ookawara S,
            Kobayashi Y, Sanui M and Morishita Y.
  TITLE     MicroRNA expression profiling in acute kidney injury
  JOURNAL   Transl Res 244, 1-31 (2022)
   PUBMED   34871811
  REMARK    GeneRIF: MicroRNA expression profiling in acute kidney injury.
REFERENCE   3  (bases 1 to 64)
  AUTHORS   Wang H, Cui Y, Luan J, Zhou X, Li C, Li H, Shi L and Han J.
  TITLE     MiR-5100 promotes osteogenic differentiation by targeting Tob2
  JOURNAL   J Bone Miner Metab 35 (6), 608-615 (2017)
   PUBMED   27873073
  REMARK    GeneRIF: These results revealed a new molecular mechanism that
            fine-tunes osteoblast differentiation through miR-5100/Tob2/osterix
            networks.
REFERENCE   4  (bases 1 to 64)
  AUTHORS   Li,C.J., Cheng,P., Liang,M.K., Chen,Y.S., Lu,Q., Wang,J.Y.,
            Xia,Z.Y., Zhou,H.D., Cao,X., Xie,H., Liao,E.Y. and Luo,X.H.
  TITLE     MicroRNA-188 regulates age-related switch between osteoblast and
            adipocyte differentiation
  JOURNAL   J Clin Invest 125 (4), 1509-1522 (2015)
   PUBMED   25751060
REFERENCE   5  (bases 1 to 64)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   6  (bases 1 to 64)
  AUTHORS   Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison
            EP, Hannon GJ, Green DR and Withoff S.
  TITLE     Ordered progression of stage-specific miRNA profiles in the mouse
            B2 B-cell lineage
  JOURNAL   Blood 117 (20), 5340-5349 (2011)
   PUBMED   21403133
REFERENCE   7  (bases 1 to 64)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   8  (bases 1 to 64)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL596215.7.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611515.1, JF446399.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                AL596215.7         157986-158049       c
FEATURES             Location/Qualifiers
     source          1..64
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 37.81 cM"
     gene            1..64
                     /gene="Mir5100"
                     /gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
                     /note="microRNA 5100"
                     /db_xref="GeneID:100628625"
                     /db_xref="MGI:MGI:4950420"
                     /db_xref="miRBase:MI0018008"
     precursor_RNA   1..64
                     /gene="Mir5100"
                     /gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
                     /product="microRNA 5100"
                     /db_xref="GeneID:100628625"
                     /db_xref="MGI:MGI:4950420"
                     /db_xref="miRBase:MI0018008"
     exon            1..64
                     /gene="Mir5100"
                     /gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           36..56
                     /ncRNA_class="miRNA"
                     /gene="Mir5100"
                     /gene_synonym="mir-5100; mmu-mir-5100; mu-mir-5100"
                     /product="mmu-miR-5100"
                     /db_xref="miRBase:MIMAT0020607"
                     /db_xref="GeneID:100628625"
                     /db_xref="MGI:MGI:4950420"
                     /db_xref="miRBase:MI0018008"
ORIGIN      
gtgggagggaggacttgggaactgaagagcagagttcgaatcccagcggtgcctcttcccgact
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]