LOCUS       NR_038057                624 bp    RNA     linear   ROD 23-APR-2024
DEFINITION  Mus musculus LIM homeobox 1, opposite strand (Lhx1os), long
            non-coding RNA.
ACCESSION   NR_038057 XR_106217 XR_106582
VERSION     NR_038057.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 624)
  AUTHORS   Pellegrini,F., Padovano,V., Biscarini,S., Santini,T., Setti,A.,
            Galfre,S.G., Silenzi,V., Vitiello,E., Mariani,D., Nicoletti,C.,
            Torromino,G., De Leonibus,E., Martone,J. and Bozzoni,I.
  TITLE     A KO mouse model for the lncRNA Lhx1os produces motor neuron
            alterations and locomotor impairment
  JOURNAL   iScience 26 (1), 105891 (2022)
   PUBMED   36647387
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 624)
  AUTHORS   Li,J., Sun,L., Peng,X.L., Yu,X.M., Qi,S.J., Lu,Z.J., Han,J.J. and
            Shen,Q.
  TITLE     Integrative genomic analysis of early neurogenesis reveals a
            temporal genetic program for differentiation and specification of
            preplate and Cajal-Retzius neurons
  JOURNAL   PLoS Genet 17 (3), e1009355 (2021)
   PUBMED   33760820
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 624)
  AUTHORS   Han,X., Luo,S., Peng,G., Lu,J.Y., Cui,G., Liu,L., Yan,P., Yin,Y.,
            Liu,W., Wang,R., Zhang,J., Ai,S., Chang,Z., Na,J., He,A., Jing,N.
            and Shen,X.
  TITLE     Mouse knockout models reveal largely dispensable but
            context-dependent functions of lncRNAs during development
  JOURNAL   J Mol Cell Biol 10 (2), 175-178 (2018)
   PUBMED   29420831
REFERENCE   4  (bases 1 to 624)
  AUTHORS   Harrow,J.L., Steward,C.A., Frankish,A., Gilbert,J.G.,
            Gonzalez,J.M., Loveland,J.E., Mudge,J., Sheppard,D., Thomas,M.,
            Trevanion,S. and Wilming,L.G.
  TITLE     The Vertebrate Genome Annotation browser 10 years on
  JOURNAL   Nucleic Acids Res 42 (Database issue), D771-D779 (2014)
   PUBMED   24316575
REFERENCE   5  (bases 1 to 624)
  AUTHORS   Thiagarajan,R.D., Cloonan,N., Gardiner,B.B., Mercer,T.R., Kolle,G.,
            Nourbakhsh,E., Wani,S., Tang,D., Krishnan,K., Georgas,K.M.,
            Rumballe,B.A., Chiu,H.S., Steen,J.A., Mattick,J.S., Little,M.H. and
            Grimmond,S.M.
  TITLE     Refining transcriptional programs in kidney development by
            integration of deep RNA-sequencing and array-based spatial
            profiling
  JOURNAL   BMC Genomics 12, 441 (2011)
   PUBMED   21888672
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 624)
  AUTHORS   Shimogori,T., Lee,D.A., Miranda-Angulo,A., Yang,Y., Wang,H.,
            Jiang,L., Yoshida,A.C., Kataoka,A., Mashiko,H., Avetisyan,M.,
            Qi,L., Qian,J. and Blackshaw,S.
  TITLE     A genomic atlas of mouse hypothalamic development
  JOURNAL   Nat Neurosci 13 (6), 767-775 (2010)
   PUBMED   20436479
REFERENCE   7  (bases 1 to 624)
  AUTHORS   Georgas,K., Rumballe,B., Valerius,M.T., Chiu,H.S.,
            Thiagarajan,R.D., Lesieur,E., Aronow,B.J., Brunskill,E.W.,
            Combes,A.N., Tang,D., Taylor,D., Grimmond,S.M., Potter,S.S.,
            McMahon,A.P. and Little,M.H.
  TITLE     Analysis of early nephron patterning reveals a role for distal RV
            proliferation in fusion to the ureteric tip via a cap
            mesenchyme-derived connecting segment
  JOURNAL   Dev Biol 332 (2), 273-286 (2009)
   PUBMED   19501082
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL603708.13.
            
            On or before Mar 26, 2011 this sequence version replaced
            XR_106582.1, XR_106217.1.
            
            Sequence Note: The RefSeq transcript was derived from genomic
            sequence to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK018772.1, BY705450.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849385, SAMN01164131
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-89                AL603708.13        65924-66012
            90-270              AL603708.13        74744-74924
            271-376             AL603708.13        75380-75485
            377-624             AL603708.13        75848-76095
FEATURES             Location/Qualifiers
     source          1..624
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 51.31 cM"
     gene            1..624
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /note="LIM homeobox 1, opposite strand"
                     /db_xref="GeneID:78365"
                     /db_xref="MGI:MGI:1925615"
     ncRNA           1..624
                     /ncRNA_class="lncRNA"
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /product="LIM homeobox 1, opposite strand"
                     /db_xref="GeneID:78365"
                     /db_xref="MGI:MGI:1925615"
     exon            1..89
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /inference="alignment:Splign:2.1.0"
     exon            90..270
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /inference="alignment:Splign:2.1.0"
     exon            271..376
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /inference="alignment:Splign:2.1.0"
     exon            377..624
                     /gene="Lhx1os"
                     /gene_synonym="1500016L03Rik; Lhx1as; ln-CR7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cggggagaccgcgtttagaggatcagtggcggcgggcccgcgcggtgccggcgactagcagcgagatgtcctggccccttccaggtttggagatggccttgggagagcaacctccggacctcagcagtgtgaggatgacaacagtaccctgtggtgctgtccccactcaggttggctgccatccctgctgatggagagaggctgaagtctgtctgagaagatagtgcaggcagctacttagctggtactaattgtatttgcagagtagggggtttctctctgtagccccgactgtcctggaactcactctgcagaccaggctgtcctcaagctcagagatctacctgcctctgcctctgaagtactgggattaaagatgcagaggcctcccagagaagtgtgaaggaatgggccttaaccagggttgaagaaagaaagtgaagaaggggagagcccaaggaaaggtggggacagttggaacttttgtttacactggtctactactcatgtatcgtatgctataatctccaaattccacatttattgtagctgtctgcagtgtgtatgccccggccgcatgctgcttggctaaaaaagtgttaaataaaactgtaagaaacgcta

//