2025-07-02 10:39:20, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_037256 83 bp RNA linear ROD 05-AUG-2023 DEFINITION Mus musculus microRNA 467a-5 (Mir467a-5), microRNA. ACCESSION NR_037256 VERSION NR_037256.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 83) AUTHORS Huang W, Cao Y, Chen C, Wu X, Sheng Z and Li A. TITLE MiR-467a-5p aggravates myocardial infarction by modulating ZEB1 expression in mice JOURNAL J Mol Histol 52 (4), 767-780 (2021) PUBMED 33997926 REMARK GeneRIF: MiR-467a-5p aggravates myocardial infarction by modulating ZEB1 expression in mice. REFERENCE 2 (bases 1 to 83) AUTHORS Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J and Li Z. TITLE miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement JOURNAL Nat Commun 6, 6789 (2015) PUBMED 25858512 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 83) AUTHORS Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA and He DZ. TITLE Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss JOURNAL PLoS One 8 (4), e62786 (2013) PUBMED 23646144 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 83) AUTHORS Polikepahad S and Corry DB. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 5 (bases 1 to 83) AUTHORS Zheng GX, Ravi A, Gould GM, Burge CB and Sharp PA. TITLE Genome-wide impact of a recently expanded microRNA cluster in mouse JOURNAL Proc Natl Acad Sci U S A 108 (38), 15804-15809 (2011) PUBMED 21911408 REFERENCE 6 (bases 1 to 83) AUTHORS Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S and Russo T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 7 (bases 1 to 83) AUTHORS Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C and Bartel DP. TITLE Mammalian microRNAs: experimental evaluation of novel and previously annotated genes JOURNAL Genes Dev 24 (10), 992-1009 (2010) PUBMED 20413612 REFERENCE 8 (bases 1 to 83) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL772216.15. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-83 AL772216.15 64633-64715 FEATURES Location/Qualifiers source 1..83 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="2" /map="2 8.22 cM" gene 1..83 /gene="Mir467a-5" /gene_synonym="Mirn467a-5; mmu-mir-467a-5" /note="microRNA 467a-5" /db_xref="GeneID:100124626" /db_xref="MGI:MGI:3719574" /db_xref="miRBase:MI0014062" precursor_RNA 1..83 /gene="Mir467a-5" /gene_synonym="Mirn467a-5; mmu-mir-467a-5" /product="microRNA 467a-5" /db_xref="GeneID:100124626" /db_xref="MGI:MGI:3719574" /db_xref="miRBase:MI0014062" exon 1..83 /gene="Mir467a-5" /gene_synonym="Mirn467a-5; mmu-mir-467a-5" /inference="alignment:Splign:2.1.0" ncRNA 15..36 /ncRNA_class="miRNA" /gene="Mir467a-5" /gene_synonym="Mirn467a-5; mmu-mir-467a-5" /product="mmu-miR-467a-5p" /db_xref="miRBase:MIMAT0003409" /db_xref="GeneID:100124626" /db_xref="MGI:MGI:3719574" /db_xref="miRBase:MI0014062" ncRNA 50..71 /ncRNA_class="miRNA" /gene="Mir467a-5" /gene_synonym="Mirn467a-5; mmu-mir-467a-5" /product="mmu-miR-467a-3p" /db_xref="miRBase:MIMAT0002108" /db_xref="GeneID:100124626" /db_xref="MGI:MGI:3719574" /db_xref="miRBase:MI0014062" ORIGIN
tgtgcctgtgtgcgtaagtgcctgcatgtatatgcgtgtatattttatgcatatacatacacacacctacacacacatgcaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]