GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-08-06 20:09:26, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030601                 96 bp    RNA     linear   ROD 05-AUG-2023
DEFINITION  Mus musculus microRNA 466d (Mir466d), microRNA.
ACCESSION   NR_030601
VERSION     NR_030601.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 96)
  AUTHORS   Jiang H, Bai L, Ji L, Bai Z, Su J, Qin T, Wang G, Balasubramaniam
            V, Wang X, Cui M, Ye J, Cao S, Li G and Yang Y.
  TITLE     Degradation of MicroRNA miR-466d-3p by Japanese Encephalitis Virus
            NS3 Facilitates Viral Replication and Interleukin-1beta Expression
  JOURNAL   J Virol 94 (15), e00294-20 (2020)
   PUBMED   32461319
  REMARK    GeneRIF: Degradation of MicroRNA miR-466d-3p by Japanese
            Encephalitis Virus NS3 Facilitates Viral Replication and
            Interleukin-1beta Expression.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 96)
  AUTHORS   Wang P, Cui J, Zhao C, Zhou L, Guo X, Shen R, Zhang J and Ling X.
  TITLE     Differential expression of microRNAs in 2-cell and 4-cell mouse
            embryos
  JOURNAL   Zygote 22 (4), 455-461 (2014)
   PUBMED   23731853
REFERENCE   3  (bases 1 to 96)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   4  (bases 1 to 96)
  AUTHORS   Huang V, Place RF, Portnoy V, Wang J, Qi Z, Jia Z, Yu A, Shuman M,
            Yu J and Li LC.
  TITLE     Upregulation of Cyclin B1 by miRNA and its implications in cancer
  JOURNAL   Nucleic Acids Res 40 (4), 1695-1707 (2012)
   PUBMED   22053081
REFERENCE   5  (bases 1 to 96)
  AUTHORS   Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ,
            Milosavljevic A, Marra MA and Rajkovic A.
  TITLE     MicroRNA transcriptome in the newborn mouse ovaries determined by
            massive parallel sequencing
  JOURNAL   Mol Hum Reprod 16 (7), 463-471 (2010)
   PUBMED   20215419
REFERENCE   6  (bases 1 to 96)
  AUTHORS   Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
            Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
            Nusbaum C and Bartel DP.
  TITLE     Mammalian microRNAs: experimental evaluation of novel and
            previously annotated genes
  JOURNAL   Genes Dev 24 (10), 992-1009 (2010)
   PUBMED   20413612
REFERENCE   7  (bases 1 to 96)
  AUTHORS   Calabrese JM, Seila AC, Yeo GW and Sharp PA.
  TITLE     RNA sequence analysis defines Dicer's role in mouse embryonic stem
            cells
  JOURNAL   Proc Natl Acad Sci U S A 104 (46), 18097-18102 (2007)
   PUBMED   17989215
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2007 Dec 26;104(52):21021]
REFERENCE   8  (bases 1 to 96)
  AUTHORS   Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
            Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
            Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
            Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
            M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
            V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
            Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
            Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
            Zavolan M and Tuschl T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   9  (bases 1 to 96)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL772216.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR7345562.3425312.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-96                AL772216.15        88001-88096
FEATURES             Location/Qualifiers
     source          1..96
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 8.22 cM"
     gene            1..96
                     /gene="Mir466d"
                     /gene_synonym="Mirn466d"
                     /note="microRNA 466d"
                     /db_xref="GeneID:100124465"
                     /db_xref="MGI:MGI:3718531"
                     /db_xref="miRBase:MI0005546"
     precursor_RNA   1..96
                     /gene="Mir466d"
                     /gene_synonym="Mirn466d"
                     /product="microRNA 466d"
                     /db_xref="GeneID:100124465"
                     /db_xref="MGI:MGI:3718531"
                     /db_xref="miRBase:MI0005546"
     exon            1..96
                     /gene="Mir466d"
                     /gene_synonym="Mirn466d"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           11..32
                     /ncRNA_class="miRNA"
                     /gene="Mir466d"
                     /gene_synonym="Mirn466d"
                     /product="mmu-miR-466d-5p"
                     /db_xref="miRBase:MIMAT0004930"
                     /db_xref="GeneID:100124465"
                     /db_xref="MGI:MGI:3718531"
                     /db_xref="miRBase:MI0005546"
     ncRNA           51..71
                     /ncRNA_class="miRNA"
                     /gene="Mir466d"
                     /gene_synonym="Mirn466d"
                     /product="mmu-miR-466d-3p"
                     /db_xref="miRBase:MIMAT0004931"
                     /db_xref="GeneID:100124465"
                     /db_xref="MGI:MGI:3718531"
                     /db_xref="miRBase:MI0005546"
ORIGIN      
catgtgtgtttgtgtgtgcgtacatgtacatgtgtgtatatgaatatacatatacatacacgcacacatagatacgcacgcacacacacacacagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]