2024-07-03 23:14:40, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NR_030570 81 bp RNA linear ROD 05-AUG-2023 DEFINITION Mus musculus microRNA 466h (Mir466h), microRNA. ACCESSION NR_030570 VERSION NR_030570.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 81) AUTHORS Luo Y, Liang C, Xu Y and Zhang T. TITLE MiR-466h-5p induces expression of myocardin with complementary promoter sequences JOURNAL Biochem Biophys Res Commun 514 (1), 187-193 (2019) PUBMED 31029421 REMARK GeneRIF: MiR-466h-5p regulates the occurrence of myocardial hypertrophy via myocardin and it can upregulate the expression of myocardin through directly binding to the promoter region of myocardin. REFERENCE 2 (bases 1 to 81) AUTHORS Polikepahad S and Corry DB. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 3 (bases 1 to 81) AUTHORS Druz A, Betenbaugh M and Shiloach J. TITLE Glucose depletion activates mmu-miR-466h-5p expression through oxidative stress and inhibition of histone deacetylation JOURNAL Nucleic Acids Res 40 (15), 7291-7302 (2012) PUBMED 22638581 REFERENCE 4 (bases 1 to 81) AUTHORS Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G and Adler H. TITLE Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68 JOURNAL J Virol 84 (19), 10266-10275 (2010) PUBMED 20668074 REFERENCE 5 (bases 1 to 81) AUTHORS Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I and Beland FA. TITLE Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice JOURNAL Lab Invest 90 (10), 1437-1446 (2010) PUBMED 20548288 REFERENCE 6 (bases 1 to 81) AUTHORS Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C and Bartel DP. TITLE Mammalian microRNAs: experimental evaluation of novel and previously annotated genes JOURNAL Genes Dev 24 (10), 992-1009 (2010) PUBMED 20413612 REFERENCE 7 (bases 1 to 81) AUTHORS Calabrese JM, Seila AC, Yeo GW and Sharp PA. TITLE RNA sequence analysis defines Dicer's role in mouse embryonic stem cells JOURNAL Proc Natl Acad Sci U S A 104 (46), 18097-18102 (2007) PUBMED 17989215 REMARK Erratum:[Proc Natl Acad Sci U S A. 2007 Dec 26;104(52):21021] REFERENCE 8 (bases 1 to 81) AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M and Tuschl T. TITLE A mammalian microRNA expression atlas based on small RNA library sequencing JOURNAL Cell 129 (7), 1401-1414 (2007) PUBMED 17604727 REFERENCE 9 (bases 1 to 81) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL772216.15. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: SRR7652917.705794.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-81 AL772216.15 90925-91005 FEATURES Location/Qualifiers source 1..81 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="2" /map="2 8.22 cM" gene 1..81 /gene="Mir466h" /gene_synonym="Mirn466h" /note="microRNA 466h" /db_xref="GeneID:100124446" /db_xref="MGI:MGI:3718537" /db_xref="miRBase:MI0005511" precursor_RNA 1..81 /gene="Mir466h" /gene_synonym="Mirn466h" /product="microRNA 466h" /db_xref="GeneID:100124446" /db_xref="MGI:MGI:3718537" /db_xref="miRBase:MI0005511" exon 1..81 /gene="Mir466h" /gene_synonym="Mirn466h" /inference="alignment:Splign:2.1.0" ncRNA 11..32 /ncRNA_class="miRNA" /gene="Mir466h" /gene_synonym="Mirn466h" /product="mmu-miR-466h-5p" /db_xref="miRBase:MIMAT0004884" /db_xref="GeneID:100124446" /db_xref="MGI:MGI:3718537" /db_xref="miRBase:MI0005511" ncRNA 50..68 /ncRNA_class="miRNA" /gene="Mir466h" /gene_synonym="Mirn466h" /product="mmu-miR-466h-3p" /db_xref="miRBase:MIMAT0017274" /db_xref="GeneID:100124446" /db_xref="MGI:MGI:3718537" /db_xref="miRBase:MI0005511" ORIGIN
tgtatatttgtgtgtgcatgtgcttgtgtgtatgtgaatatatatatcatacgcacgcacacacacacacaaatgcaagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]