2025-10-14 05:57:13, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_145707 1603 bp mRNA linear ROD 27-APR-2025 DEFINITION Mus musculus oocyte specific homeobox 3 (Obox3), mRNA. ACCESSION NM_145707 XM_908582 VERSION NM_145707.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1603) AUTHORS Sakamoto,M., Ito,A., Wakayama,S., Sasaki,H., Wakayama,T. and Ishiuchi,T. TITLE Detection of newly synthesized RNA reveals transcriptional reprogramming during ZGA and a role of Obox3 in totipotency acquisition JOURNAL Cell Rep 43 (4), 114118 (2024) PUBMED 38619966 REMARK GeneRIF: Detection of newly synthesized RNA reveals transcriptional reprogramming during ZGA and a role of Obox3 in totipotency acquisition. REFERENCE 2 (bases 1 to 1603) AUTHORS Ji,S., Chen,F., Stein,P., Wang,J., Zhou,Z., Wang,L., Zhao,Q., Lin,Z., Liu,B., Xu,K., Lai,F., Xiong,Z., Hu,X., Kong,T., Kong,F., Huang,B., Wang,Q., Xu,Q., Fan,Q., Liu,L., Williams,C.J., Schultz,R.M. and Xie,W. TITLE OBOX regulates mouse zygotic genome activation and early development JOURNAL Nature 620 (7976), 1047-1053 (2023) PUBMED 37459895 REFERENCE 3 (bases 1 to 1603) AUTHORS Thompson,C.L., Ng,L., Menon,V., Martinez,S., Lee,C.K., Glattfelder,K., Sunkin,S.M., Henry,A., Lau,C., Dang,C., Garcia-Lopez,R., Martinez-Ferre,A., Pombero,A., Rubenstein,J.L.R., Wakeman,W.B., Hohmann,J., Dee,N., Sodt,A.J., Young,R., Smith,K., Nguyen,T.N., Kidney,J., Kuan,L., Jeromin,A., Kaykas,A., Miller,J., Page,D., Orta,G., Bernard,A., Riley,Z., Smith,S., Wohnoutka,P., Hawrylycz,M.J., Puelles,L. and Jones,A.R. TITLE A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain JOURNAL Neuron 83 (2), 309-323 (2014) PUBMED 24952961 REFERENCE 4 (bases 1 to 1603) AUTHORS Guo,G., Huss,M., Tong,G.Q., Wang,C., Li Sun,L., Clarke,N.D. and Robson,P. TITLE Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst JOURNAL Dev Cell 18 (4), 675-685 (2010) PUBMED 20412781 REFERENCE 5 (bases 1 to 1603) AUTHORS Yokoyama,S., Ito,Y., Ueno-Kudoh,H., Shimizu,H., Uchibe,K., Albini,S., Mitsuoka,K., Miyaki,S., Kiso,M., Nagai,A., Hikata,T., Osada,T., Fukuda,N., Yamashita,S., Harada,D., Mezzano,V., Kasai,M., Puri,P.L., Hayashizaki,Y., Okado,H., Hashimoto,M. and Asahara,H. TITLE A systems approach reveals that the myogenesis genome network is regulated by the transcriptional repressor RP58 JOURNAL Dev Cell 17 (6), 836-848 (2009) PUBMED 20059953 REFERENCE 6 (bases 1 to 1603) AUTHORS Cheng,W.C., Hsieh-Li,H.M., Yeh,Y.J. and Li,H. TITLE Mice lacking the Obox6 homeobox gene undergo normal early embryonic development and are fertile JOURNAL Dev Dyn 236 (9), 2636-2642 (2007) PUBMED 17676645 REFERENCE 7 (bases 1 to 1603) AUTHORS Yeh,Y.J., Choo,K.B., Cheng,W.T. and Li,H. TITLE Ohx is a homeobox-encoding gene preferentially expressed in mature oocytes JOURNAL Mech Dev 117 (1-2), 259-263 (2002) PUBMED 12204267 REFERENCE 8 (bases 1 to 1603) AUTHORS Rajkovic,A., Yan,C., Yan,W., Klysik,M. and Matzuk,M.M. TITLE Obox, a family of homeobox genes preferentially expressed in germ cells JOURNAL Genomics 79 (5), 711-717 (2002) PUBMED 11991721 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK139750.1. On May 17, 2008 this sequence version replaced NM_145707.2. ##Evidence-Data-START## Transcript exon combination :: AK139750.1, BY725694.1 [ECO:0000332] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1603 AK139750.1 2-1604 FEATURES Location/Qualifiers source 1..1603 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 8.53 cM" gene 1..1603 /gene="Obox3" /gene_synonym="Ohx" /note="oocyte specific homeobox 3" /db_xref="GeneID:246791" /db_xref="MGI:MGI:2149032" exon 1..48 /gene="Obox3" /gene_synonym="Ohx" /inference="alignment:Splign:2.1.0" exon 49..121 /gene="Obox3" /gene_synonym="Ohx" /inference="alignment:Splign:2.1.0" exon 122..383 /gene="Obox3" /gene_synonym="Ohx" /inference="alignment:Splign:2.1.0" misc_feature 149..151 /gene="Obox3" /gene_synonym="Ohx" /note="upstream in-frame stop codon" CDS 167..1174 /gene="Obox3" /gene_synonym="Ohx" /note="oocyte-specific homeobox" /codon_start=1 /product="oocyte-specific homeobox protein 3" /protein_id="NP_663753.3" /db_xref="CCDS:CCDS20838.1" /db_xref="GeneID:246791" /db_xref="MGI:MGI:2149032" /translation="
MAEGPSLHPKLQVASNIPIELSSQIPQDPARNLAFQMCQNPLMTPGSTMQSRLSVPERNLLQQESQGPTRQSGRMPLSDRYVNKQTGPMALRKFRKERTVYSKEQQCLLQKHFDEFQYPNEKKIVELALSVGVTKREIKIWFKNNRAKYRRMKLQNIKQALPETNESSKAVSESTHFPGSIPVVDSDNGESMCSGTFGEDSIPKLNCSQESSLHCFQACDGDMCCPQEYQEYQEYLLHGHAPVTAWNSGQSAAFESQTDLAVAEVPVGLAYAAQAPEDAHNSGPCEDELWQRILEDLDTSDDWLTLRNLSTPVYTTEVLDQSKPYSHEEVCYTHL"
misc_feature 347..409 /gene="Obox3" /gene_synonym="Ohx" /note="propagated from UniProtKB/Swiss-Prot (Q3UT54.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 449..625 /gene="Obox3" /gene_synonym="Ohx" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(449..463,467..469,518..520,536..538,575..577, 581..586,593..598,602..610,614..619) /gene="Obox3" /gene_synonym="Ohx" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(455..457,464..466,584..586,593..598,605..607) /gene="Obox3" /gene_synonym="Ohx" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 384..583 /gene="Obox3" /gene_synonym="Ohx" /inference="alignment:Splign:2.1.0" exon 584..1603 /gene="Obox3" /gene_synonym="Ohx" /inference="alignment:Splign:2.1.0" regulatory 1579..1584 /regulatory_class="polyA_signal_sequence" /gene="Obox3" /gene_synonym="Ohx" /note="putative" polyA_site 1603 /gene="Obox3" /gene_synonym="Ohx" /note="putative" ORIGIN
aaaacagccagaggatttagcaagttacagcaaccgtctggattcctggcagaggtccaagtcctggattgtatagagaacccgacatcaaccaatggagaggcctgcttctaggacgaaggttctccagtacaggaacatactccaataagttctgaacacacacatggccgaaggcccctccttgcatccaaaactccaagtggcttcgaatatacccatagaactcagttcccaaatacctcaagaccctgcaaggaacttagcttttcaaatgtgtcagaatcccctaatgactccaggaagtacaatgcaatcaagactttcagtccctgaaaggaacctacttcagcaagagtctcaaggaccaacaagacaatcaggtcgtatgccactgtcagatagatatgttaacaaacaaactggccctatggctttaagaaagtttcgaaaagaacgcactgtgtactccaaagaacagcagtgcctgctgcaaaaacattttgatgagttccagtacccaaacgagaagaaaattgtggagctggcactatcagttggtgttacaaagagggagatcaagatctggttcaagaacaaccgagctaagtacaggcggatgaagctccagaatataaaacaagcactgccagagacaaatgaaagctctaaagcggtttctgagtcaacccattttcctggttccatacctgttgttgactcggacaatggagagtccatgtgttcaggcacatttggtgaggattccattcccaaactcaactgcagccaggaatcttccctgcattgttttcaggcctgtgatggggacatgtgttgtccgcaagaataccaagaataccaagaatacctgcttcatggccatgcccctgttacagcttggaactctggtcaatcagcagcatttgaatctcaaactgacttagcagtagctgaagttccagtcggcctggcatatgccgcccaagccccagaggatgctcacaattcaggtccatgtgaagatgagctctggcaaaggatccttgaagacttggacacatcagatgactggcttactctgagaaacctctccactccagtttacaccactgaggtccttgaccagtccaagccttacagccatgaagaagtgtgttatacacacctttagtgtcagtatttggagaaaattttattttacttttttattgggtatttatttcatttacatttccaatgctatcccaaaagacccccctaccctccccccttcccttcccacttcttggccctggcattcccctgtactgaggcagataaagtttgcacgaccaatgagtgtaatcactttgagagcacataattcggagtccattggtagaaaatgatactttgtttagtatatatttggggtggctgtggattcatgcaatatagggactcgctatcaagtctaactccagttatatgattacctacgccctctccttgcttcagaggtcactacatgcaacaggaaccctcatatacatgcagaacttgcaatcatatgatagaaaagcaatacatctgataaataaatactgtgagccaactcccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]