LOCUS       NM_026280               1725 bp    mRNA    linear   ROD 12-NOV-2023
DEFINITION  Mus musculus matrix-remodelling associated 7 (Mxra7), transcript
            variant 1, mRNA.
ACCESSION   NM_026280 XM_126676
VERSION     NM_026280.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1725)
  AUTHORS   Shen Y, Ning J, Zhao L, Liu W, Wang T, Yu J and Wang Y.
  TITLE     Matrix remodeling associated 7 proteins promote cutaneous wound
            healing through vimentin in coordinating fibroblast functions
  JOURNAL   Inflamm Regen 43 (1), 5 (2023)
   PUBMED   36647132
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1725)
  AUTHORS   Zheng YD, Sun ZJ, Ma KP, Wang YQ and Lin DD.
  TITLE     [The Effect of Matrix Remodeling Associated 7 (MXRA7) Expression on
            the Biological Function of SHI-1 Cells]
  JOURNAL   Zhongguo Shi Yan Xue Ye Xue Za Zhi 30 (3), 688-694 (2022)
   PUBMED   35680791
  REMARK    GeneRIF: [The Effect of Matrix Remodeling Associated 7 (MXRA7)
            Expression on the Biological Function of SHI-1 Cells].
REFERENCE   3  (bases 1 to 1725)
  AUTHORS   Zhou Z, Shen Y, Yin J, Xi F, Xu R, Lin D, Saijilafu, Chen J and
            Wang Y.
  TITLE     Matrix remodeling associated 7 promotes differentiation of bone
            marrow mesenchymal stem cells toward osteoblasts
  JOURNAL   J Cell Physiol 234 (10), 18053-18064 (2019)
   PUBMED   30843215
  REMARK    GeneRIF: MXRA7 influences bone formation by regulating the balance
            between osteogenesis and adipogenesis in bone marrow mesenchymal
            stem cells.
            GeneRIF: MXRA7 influences bone formation via regulating the balance
            between osteogenesis and adipogenesis in bone marrow mesenchymal
            stem cells. Deficiency of MXRA7 in mice leads to shorter tibia.
REFERENCE   4  (bases 1 to 1725)
  AUTHORS   Ning J, Shen Y, Wang T, Wang M, Liu W, Sun Y, Zhang F, Chen L and
            Wang Y.
  TITLE     Altered expression of matrix remodelling associated 7 (MXRA7) in
            psoriatic epidermis: Evidence for a protective role in the
            psoriasis imiquimod mouse model
  JOURNAL   Exp Dermatol 27 (9), 1038-1042 (2018)
   PUBMED   29781547
  REMARK    GeneRIF: These data demonstrated that MXRA7 gene might function as
            a negative modulator in psoriasis development when propsoriatic
            factors attack, presumably via expression alteration or
            redistribution of MXRA7 proteins in keratinocytes.
            GeneRIF: MXRA7 gene might function as a negative modulator in
            psoriasis development when propsoriatic factors attack, presumably
            via expression alteration or redistribution of MXRA7 proteins in
            keratinocytes.
REFERENCE   5  (bases 1 to 1725)
  AUTHORS   Lin D, Sun Z, Jin Z, Lei L, Liu Y, Hu B, Wang B, Shen Y and Wang Y.
  TITLE     Matrix Remodeling Associated 7 Deficiency Alleviates Carbon
            Tetrachloride-Induced Acute Liver Injury in Mice
  JOURNAL   Front Immunol 9, 773 (2018)
   PUBMED   29720975
  REMARK    GeneRIF: We concluded that MXRA7 was an active player in
            CCl4-induced liver injury
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1725)
  AUTHORS   Jia C, Zhang F, Zhu Y, Qi X and Wang Y.
  TITLE     Public data mining plus domestic experimental study defined
            involvement of the old-yet-uncharacterized gene matrix-remodeling
            associated 7 (MXRA7) in physiopathology of the eye
  JOURNAL   Gene 632, 43-49 (2017)
   PUBMED   28847716
  REMARK    GeneRIF: MXRA7 is under-expressed during corneal infection and
            neovascularization.
REFERENCE   7  (bases 1 to 1725)
  AUTHORS   Dickinson ME, Flenniken AM, Ji X, Teboul L, Wong MD, White JK,
            Meehan TF, Weninger WJ, Westerberg H, Adissu H, Baker CN, Bower L,
            Brown JM, Caddle LB, Chiani F, Clary D, Cleak J, Daly MJ, Denegre
            JM, Doe B, Dolan ME, Edie SM, Fuchs H, Gailus-Durner V, Galli A,
            Gambadoro A, Gallegos J, Guo S, Horner NR, Hsu CW, Johnson SJ,
            Kalaga S, Keith LC, Lanoue L, Lawson TN, Lek M, Mark M, Marschall
            S, Mason J, McElwee ML, Newbigging S, Nutter LM, Peterson KA,
            Ramirez-Solis R, Rowland DJ, Ryder E, Samocha KE, Seavitt JR,
            Selloum M, Szoke-Kovacs Z, Tamura M, Trainor AG, Tudose I, Wakana
            S, Warren J, Wendling O, West DB, Wong L, Yoshiki A, MacArthur DG,
            Tocchini-Valentini GP, Gao X, Flicek P, Bradley A, Skarnes WC,
            Justice MJ, Parkinson HE, Moore M, Wells S, Braun RE, Svenson KL,
            de Angelis MH, Herault Y, Mohun T, Mallon AM, Henkelman RM, Brown
            SD, Adams DJ, Lloyd KC, McKerlie C, Beaudet AL, Bucan M and Murray
            SA.
  CONSRTM   International Mouse Phenotyping Consortium; Jackson Laboratory;
            Infrastructure Nationale PHENOMIN, Institut Clinique de la Souris
            (ICS); Charles River Laboratories; MRC Harwell; Toronto Centre for
            Phenogenomics; Wellcome Trust Sanger Institute; RIKEN BioResource
            Center
  TITLE     High-throughput discovery of novel developmental phenotypes
  JOURNAL   Nature 537 (7621), 508-514 (2016)
   PUBMED   27626380
  REMARK    Erratum:[Nature. 2017 Nov 16;551(7680):398. PMID: 29144450]
REFERENCE   8  (bases 1 to 1725)
  AUTHORS   Abe K, Yamamoto R, Franke V, Cao M, Suzuki Y, Suzuki MG, Vlahovicek
            K, Svoboda P, Schultz RM and Aoki F.
  TITLE     The first murine zygotic transcription is promiscuous and uncoupled
            from splicing and 3' processing
  JOURNAL   EMBO J 34 (11), 1523-1537 (2015)
   PUBMED   25896510
REFERENCE   9  (bases 1 to 1725)
  AUTHORS   Probert F, Rice P, Scudamore CL, Wells S, Williams R, Hough TA and
            Cox IJ.
  TITLE     (1)H NMR metabolic profiling of plasma reveals additional
            phenotypes in knockout mouse models
  JOURNAL   J Proteome Res 14 (5), 2036-2045 (2015)
   PUBMED   25849460
REFERENCE   10 (bases 1 to 1725)
  AUTHORS   Munton RP, Tweedie-Cullen R, Livingstone-Zatchej M, Weinandy F,
            Waidelich M, Longo D, Gehrig P, Potthast F, Rutishauser D, Gerrits
            B, Panse C, Schlapbach R and Mansuy IM.
  TITLE     Qualitative and quantitative analyses of protein phosphorylation in
            naive and stimulated mouse synaptosomal preparations
  JOURNAL   Mol Cell Proteomics 6 (2), 283-293 (2007)
   PUBMED   17114649
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK075801.1 and CX734756.1.
            
            On Oct 31, 2009 this sequence version replaced NM_026280.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK075801.1, BC147321.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849380, SAMN00849381
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1516              AK075801.1         2-1517
            1517-1725           CX734756.1         290-498
FEATURES             Location/Qualifiers
     source          1..1725
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 81.49 cM"
     gene            1..1725
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="matrix-remodelling associated 7"
                     /db_xref="GeneID:67622"
                     /db_xref="MGI:MGI:1914872"
     exon            1..318
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /inference="alignment:Splign:2.1.0"
     CDS             49..585
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; matrix-remodeling-associated protein 7;
                     transmembrane anchor protein 1"
                     /codon_start=1
                     /product="matrix-remodeling-associated protein 7 isoform 1
                     precursor"
                     /protein_id="NP_080556.1"
                     /db_xref="CCDS:CCDS25677.1"
                     /db_xref="GeneID:67622"
                     /db_xref="MGI:MGI:1914872"
                     /translation="

MESPVELLAALPALVTALALLLAWLLLRRGAARVPAPESTASDEAPGAPAPPEPPESCAPEPAPEGPSQSERVAEPEESEAEEPAAEGRQDEDSDSEMGPPTEEPEEEDGAAFSFKYSPGQLRGSQYKKMMTKEELEEEHRVQKEQLAAIFKLMKDNKDTFGEMSDGDMQEQLRLYDM"

     sig_peptide     49..144
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    67..129
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9CZH7.2);
                     transmembrane region"
     misc_feature    145..426
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9CZH7.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    283..285
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:15345747,
                     ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079;
                     propagated from UniProtKB/Swiss-Prot (Q9CZH7.2);
                     phosphorylation site"
     misc_feature    541..543
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (Q9CZH7.2); phosphorylation site"
     exon            319..376
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            377..470
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /inference="alignment:Splign:2.1.0"
     exon            471..1725
                     /gene="Mxra7"
                     /gene_synonym="1810057P16Rik; E130302J09Rik"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gggttccctcggggtccgggctggcggccactcggcggccacggcgcgatggagtcgccggtcgagctgctggccgcgctacccgcgctggtcacggcgctggcgctgctgctcgcctggctgctgctgcggcgtggggcggcccgggtcccggccccggagagcaccgcctcggacgaggcccccggggctcctgcgccgcctgaacctccagagtcttgcgccccggagcctgcaccggagggaccgagccagtccgagcgcgtggcggagccggaggagtccgaggcggaggagccagcggccgaggggaggcaggatgaagactcagacagtgagatggggccacccactgaagaacctgaggaagaagacggagcagccttctcctttaaatacagccctgggcagctgaggggaagccagtacaagaagatgatgaccaaagaagaactggaggaggaacacagagttcagaaagaacagctggctgccatcttcaagctcatgaaggacaacaaggacacctttggcgagatgtcagacggggacatgcaggagcaactccgactctatgacatgtaggcctgtcacccggcaagatgtgacccaggacatcatgacaactctgagggactcggcccaggcagttagttgtgactcccagacctttgtttgaaagactgtcttataaaaacagagagacctatgttatgtaaggatctgcaatttatatatcacatcagaggaacctacatcatttcttcagggaggaaaccccagatcgccctggcttcagcttgctggtgtgggttcagctgggccgtgttctacagactcagagtgggtgggccaggggagatgatgagactcggtgtttggcacctaagtatttagtgtagacaaaatacggggcgctatggggggaggatataggtgtgatctagtaacaccacactcttcattctgccctagggttatttctggaagcatctggggtggtagttgaagcaagcagtagaggagcaatattttagtaaatgtctgattgaaaggtccagccatcaccctggggcagaaccgtggggtcactgctgaagcttgtcctcagtacagtcacgccttgagtgtgtttgtcacacagaagattatgccagatacatagcaggagccctgggtagagcatgtgtgtgctaagatcaaggcccctgagttccacccccagcaccagacaccttcttccccacaccctaccgcagctcaaaaaagacaacataatcagtccctttggtgagaccaatggcctttagagaatgagaaactaccagaaagcatcccggtgtcctctagaataagtgccaagggagatcactcagcaacgatgggggtgggggtcacagcagctcctttatacccacatcttgttctacttcttatcaccccactggccagaaagttcataggctgagcagacttgagtcaaggttatcctaaggaaagaagaaggaaggttttttgtttttctttttccagacagggtttctctgtgtagccccggctgtcctggagctcgctctgtagaccaggctggtctggaactcagagatccacctgcctctgcctccgagtgctgggattaaagccttgcgccaccactgcctggccagtgggaaagctcttaaggtccgtttttatttgctaaaataaagctaaattgatatagag

//